NAU1255

Marker Overview
NameNAU1255
AliasNAU1042=NAU1255
Genbank IDBF271636
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8400
AKA 8400
Source TypeEST
Repeat Motif(GCTCAT)3
PCR ConditionAnnealing temperature: 57
Primer 1NAU1255_F: CATGCAAATCCATGCTAGAG
Primer 2NAU1255_R: GGTTTCTTTGGTGGTGAAAC
Product Length241
Restriction EnzymeEcoRI; XhoI
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankBF271636
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Zhongmiansuo-12 x 8891, RIL (2007)Zhongmiansuo-12 x 8891, RIL (2007).Z8-RIL_ch19/D05N/AAD_chr.190.2NAU1255View
2Yumian-1 x T586, RIL (2006)YT-RIL_chr05-2N/AAD_chr.0513.2NAU1255View
3Yumian-1 x T586, RIL (2015)YT-RIL.15_chr05N/AAD_chr.0552NAU1255View
4Baimian 1 x TM-1 , F2:3 (2014)BT-F2:3_chr19-2N/AAD_chr.1920.1NAU1255View
5Yumian-1 x 7235, RIL (2015)Y7-RIL_chr05N/AAD_chr.0514.9NAU1255View
6TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr19-1N/AAD_chr.1921.9NAU1255View
7GX1135 x GX100-2, F2 (2013)GG-F2_chr19-2N/AAD_chr.1945.7NAU1255View
8CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr05N/AAt.0591.4NAU1255View
9CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr19N/ADt.05124.5NAU1255View
10CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr05N/AAD_chr.0556NAU1255View
11Yumian-1 x T586, RIL (2009)YT-RIL_chr05N/AAD_chr.0513.2NAU1255/210yView
12(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part.SSZ8-4WC_A05-3N/AAD_chr.050.6NAU1225View
13Zhongmiansuo-12 x 8891, RIL (2007)Zhongmiansuo-12 x 8891, RIL (2007).Z8-RIL_ch19/D05N/AAD_chr.190.2NAU1225View
14Yumian-1 x T586, RIL (2006)YT-RIL_chr05-2N/AAD_chr.050NAU1225View
1560182 x Jun Mian 1, F2:3 (2007)6J-F2:3_chr23N/AAD_chr.230NAU1225View
16Yumian-1 x T586, RIL (2015)YT-RIL.15_chr05N/AAD_chr.0549.4NAU1225View
17PD6992 x SM3, F2:3 (2005)PDSM-F2:3_chr19/LGD08-1N/AAD_chr.190.8NAU1225View
18Yumian-1 x 7235, RIL (2015)Y7-RIL_chr05N/AAD_chr.0511.3NAU1225View
190-153 x sGK9708, RIL (2016)0s-RIL_chr19-1N/AAD_chr.1917.4NAU1225View
20CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr05N/AAt.0590.8NAU1225View
21CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr19N/ADt.05124.9NAU1225View
22CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr05N/AAD_chr.0557.6NAU1225View
23CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr05N/AAt.0598.83NAU1255-98.833View
Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU1255_FNAU1255_FGossypium arboreumprimer
NAU1255_RNAU1255_RGossypium arboreumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
lint percentqLP.BT-F2:3_chr19-2.2010Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU1255NAU1255Gossypium arboreummarker_locus
NAU1255/210yNAU1255/210yGossypium arboreummarker_locus
NAU1225NAU1225Gossypium arboreummarker_locus
NAU1255NAU1255-98.833Gossypium arboreummarker_locus


Germplasm
Stock NameType
AKA 8400TBD
AKA 8400TBD