NAU1233

Marker Overview
NameNAU1233
Genbank IDBG439856
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8400
AKA 8400
Source TypeEST
Repeat Motif(AAT)6
PCR ConditionAnnealing temperature: 57
Primer 1NAU1233_F: TTCGGGAAAGTTAGAGGAGA
Primer 2NAU1233_R: TCCTCAGAGCTCGGAATAGT
Product Length245
Restriction EnzymeEcoRI; XhoI
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankBG439856
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part.SSZ8-4WC_A11-1N/AAD_chr.1146.7NAU1233View
2Zhongmiansuo-12 x 8891, RIL (2007)Zhongmiansuo-12 x 8891, RIL (2007).Z8-RIL_ch10/A10N/AAD_chr.1040.2NAU1233View
3(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr21-3N/AAD_chr.2184.9NAU1233View
4PD6992 x SM3, F2:3 (2005)PDSM-F2:3_chr11/LGA03-2N/AAD_chr.112.7NAU1233View
5CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr11N/AAD_chr.11135.9NAU1233View
6CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr11N/AAt.110NAU1233View
Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU1233_FNAU1233_FGossypium arboreumprimer
NAU1233_RNAU1233_RGossypium arboreumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU1233NAU1233Gossypium arboreummarker_locus


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chr07chromosomeNAU1233:1..697 .
Chr07:425298..426003 -
Chr7chromosomeNAU1233:1..697 .
Chr7:55045632..55046337 +
Germplasm
Stock NameType
AKA 8400TBD
AKA 8400TBD
Sequence
>NAU1233 ID=NAU1233|Name=NAU1233|organism=Gossypium arboreum|type=genetic_marker|length=245bp
TTCGGGAAAGTTAGAGGAGAGGATCGGTTTTATATTCCAGTAAAAGCTAG
AAGAAATCAAAACCAGAAGCAACAGCAAAAGCCAAAACAAGAAGCTATTA
AGGAAGATAATGAAAAAAGTAATAGTAAATCGTCAGCTTCATTAACGAAG
AGCAAGGATTTAGCTTCTGGTAATAATAATAATAATAATAAGAATATTAA
TCCCAAGAAGACTTTGGCTTCAAGTACTATTCCGAGCTCTGAGGA