MUSS0138

Marker Overview
NameMUSS0138
AliasMUSS138
Genbank IDN/A
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8401
Source TypeEST
Repeat MotifTCT(6)
PCR ConditionAnnealing temperature: 55
Primer 1MUSS138_F: TCTCCAGATCTCTCTGTCTCCC
Primer 2MUSS138_R: CGTGTCCGAAACTTCCTAGC
Product Length209
ContactUlloa, Mauricio
CommentPrimer data obtained in 2007-11
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr19-5N/AAD_chr.1979.4MUSS138View
2CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr19N/AAD_chr.19105MUSS138View
3CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr19N/ADt.05173.15MUSS138-173.148View
Contact
NameDetails
Ulloa, Mauricio
Description:Breeding, genetics, and Genomics
First name:Mauricio
Last name:Ulloa
Title:Research Geneticist
Institution:USDA-ARS, W.I.C.S., Res. Unit
Address:17053 N. Shafter Ave., Shafter, California 93263
Country:United States
Email:mauricio.ulloa@ars.usda.gov
Phone:661-746-8009
Fax:746-746-1619
Keywords:Breeding and Genomics
Last update:27-Apr-2010
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
MUSS138_FMUSS138_FGossypium arboreumprimer
MUSS138_RMUSS138_RGossypium arboreumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
MUSS138MUSS138Gossypium arboreummarker_locus
MUSS138MUSS138-173.148Gossypium arboreummarker_locus


Germplasm
Stock NameType
AKA 8401TBD
Sequence
>MUSS0138 ID=MUSS0138|Name=MUSS0138|organism=Gossypium arboreum|type=genetic_marker|length=209bp
TCTCCAGATCTCTCTGTCTCCCCCTTCTCTTTCTATCTGAAACCAAATAA
AAATAAATTCGTGAACACCATGGCAGTCTGCTCGTCTTCTTCTTCTTCTT
CTTCAACAGGTAAAGCTTGGATAGTTCACAGTATTTTAGCTGGCACAGCA
ATTGCGGTAGCCATTGGTGCCCATGCCTATCTGGGTCGGGCTAGGAAGTT
TCGGACACG