MUSS0095

Marker Overview
NameMUSS0095
AliasMUSS095
Genbank IDN/A
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8401
Source TypeEST
Repeat MotifTGA(6)
PCR ConditionAnnealing temperature: 55
Primer 1MUSS095_F: GCAACCATTAATTAAGCAAGTAACAA
Primer 2MUSS095_R: CGAAGAATATGTGAACCTACAGAAAC
Product Length157
ContactUlloa, Mauricio
CommentPrimer data obtained in 2007-11
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr16N/AAD_chr.16146.26MUSS095View
2TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c16N/AAD_chr.164.4MUSS095View
3TM-1 x 3-79, RIL (2014)T3-RIL.14_chr16N/AAD_chr.16121.9MUSS095View
4W10 x TM-1, F2:3 (2015)WT-F2:3_chr16-3N/AAD_chr.160.4MUSS095View
5CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr07N/AAt.07148MUSS095View
6CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr16N/AAD_chr.1624.1MUSS095View
70-153 x sGK9708, RIL (2016)0s-RIL_chr16N/AAD_chr.1615.8MUSS95View
8CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr16N/ADt.079.68MUSS095-9.684View
9TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.16N/AAD_chr.16121.9MUSS095-121.903View
Contact
NameDetails
Ulloa, Mauricio
Description:Breeding, genetics, and Genomics
First name:Mauricio
Last name:Ulloa
Title:Research Geneticist
Institution:USDA-ARS, W.I.C.S., Res. Unit
Address:17053 N. Shafter Ave., Shafter, California 93263
Country:United States
Email:mauricio.ulloa@ars.usda.gov
Phone:661-746-8009
Fax:746-746-1619
Keywords:Breeding and Genomics
Last update:27-Apr-2010
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
MUSS095_FMUSS095_FGossypium arboreumprimer
MUSS095_RMUSS095_RGossypium arboreumprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber strengthqFS.CY-RIL_ch16.swu08Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
MUSS095MUSS095Gossypium arboreummarker_locus
MUSS95MUSS95Gossypium arboreummarker_locus
MUSS095MUSS095-9.684Gossypium arboreummarker_locus
MUSS095MUSS095-121.903Gossypium arboreummarker_locus


Germplasm
Stock NameType
AKA 8401TBD
Sequence
>MUSS0095 ID=MUSS0095|Name=MUSS0095|organism=Gossypium arboreum|type=genetic_marker|length=157bp
GCAACCATTAATTAAGCAAGTAACAAGGTTTTCTTTGTAGTTAATAACAT
ATCAAAGATTTGATGATGATGATGATGATGGCACCACATAATCAACAACT
ATGACACCATCCAAATAATCCCTAACCTTCTGTTTCTGTAGGTTCACATA
TTCTTCG