MUSS0035

Marker Overview
NameMUSS0035
AliasMUSS035
Genbank IDN/A
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8401
Source TypeEST
Repeat MotifTTCTG(4)
PCR ConditionAnnealing temperature: 55
Primer 1MUSS035_F: GCTTAACAGAAAAGATCTTAAAACCC
Primer 2MUSS035_R: ATTAGAACGACAACTGTAATGGAGC
Product Length195
ContactUlloa, Mauricio
CommentPrimer data obtained in 2007-11
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr26N/AAD_chr.2641.3MUSS035View
2CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr26N/ADt.12137.61MUSS035-137.61View
Contact
NameDetails
Ulloa, Mauricio
Description:Breeding, genetics, and Genomics
First name:Mauricio
Last name:Ulloa
Title:Research Geneticist
Institution:USDA-ARS, W.I.C.S., Res. Unit
Address:17053 N. Shafter Ave., Shafter, California 93263
Country:United States
Email:mauricio.ulloa@ars.usda.gov
Phone:661-746-8009
Fax:746-746-1619
Keywords:Breeding and Genomics
Last update:27-Apr-2010
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
MUSS035_FMUSS035_FGossypium arboreumprimer
MUSS035_RMUSS035_RGossypium arboreumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
MUSS035MUSS035Gossypium arboreummarker_locus
MUSS035MUSS035-137.61Gossypium arboreummarker_locus


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chr08chromosomeMUSS0035:5..354 .
Chr08:54134469..54134814 -
Chr8chromosomeMUSS0035:5..354 .
Chr8:7146612..7146957 +
Germplasm
Stock NameType
AKA 8401TBD
Sequence
>MUSS0035 ID=MUSS0035|Name=MUSS0035|organism=Gossypium arboreum|type=genetic_marker|length=195bp
GCTTAACAGAAAAGATCTTAAAACCCTTTTCTGTTCTGTTCTGTTCTGTT
CTTTGTTTTTATTTTTGTTGGGTTTCAACAACTGCGTGTGGACATAAAAC
ACTTGTTGAGAAAACAGTGCGAGAATTCTCATTCAATCATTGCTCTTATC
AACCTTTTTTTTTCCCACCAGCTCCATTACAGTTGTCGTTCTAAT