MUSB1267

Marker Overview
NameMUSB1267
Genbank IDDX558326
TypeSSR
SpeciesGossypium hirsutum
GermplasmAcala Maxxa
Source SequenceDX558326.2
Source TypeEST
Repeat Motif(ATT)4
PCR ConditionAnnealing temperature: 50
Primer 1MUSB1267_F: TCATGGTGACACATGGCAGTC
Primer 2MUSB1267_R: CATGAACATAGCACTGACGGCT
Product Length137
Restriction EnzymeHindIII; NotI
PolymorphismP_ MUSB1267
Publication[view all]
CommentPrimer data obtained in 2006
References
External references for this genetic_marker
DatabaseAccession
DB:genbankDX558326
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1TM-1 x 3-79, RIL (2006)TM-1 x 3-79, RIL (2006).T3-RIL_chr.15bN/AAD_chr.157.6musb1267View
2TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c15N/AAD_chr.1566.96musb1267View
3AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr15N/AAD_chr.1590musb1267View
4DH962 x Jinmian-6, F2 (2009)DJ-F2_chr15N/AAD_chr.1555.5musb1267View
5DH962 x Jinmian-6, F2 (2009)DJ-F2_chr15/LG14N/AAD_chr.1555.5musb1267View
6DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr01N/AAD_chr.0122.09musb1267View
7DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr15-1N/AAD_chr.1522.09musb1267View
8TM-1 x 3-79, RIL (2014)T3-RIL.14_chr15N/AAD_chr.1552.9musb1267View
9DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr21-1N/AAD_chr.21-148.4musb1267View
10CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr15N/ADt.0163.64MUSB1267-63.644View
11TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.15N/AAD_chr.1552.94MUSB1267-52.936View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
MUSB1267_FMUSB1267_FGossypium hirsutumprimer
MUSB1267_RMUSB1267_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber finenessqFF.T3-RIL_ch15.bbGossypium spp.QTL
short fiber contentqSFC.T3-RIL_ch15.csGossypium spp.QTL
fiber lengthqFL.DJiM-RIL_ch21-1.hj08-13Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
musb1267musb1267Gossypium hirsutummarker_locus
MUSB1267MUSB1267-63.644Gossypium hirsutummarker_locus
MUSB1267MUSB1267-52.936Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DX558326.2DX558326.2Gossypium hirsutumsequence_feature


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
CM017701.1chromosomeCM017701.1:43977749..43977890 -
CM017649.1chromosomeCM017649.1:45716953..45717093 -
CM017623.1chromosomeCM017623.1:44557374..44557515 -
D01chromosomeD01:44573519..44573661 -
Gbar_D01chromosomeGbar_D01:43768851..43768993 -
scaffold24022supercontigscaffold24022:25689..25831 -
Dt01chromosomeDt01:41815725..41815867 -
D01chromosomeD01:42347378..42347519 -
D01chromosomeD01:44841508..44841644 -
D01chromosomeD01:45392560..45392696 -
Ghir_D01chromosomeGhir_D01:43457310..43457446 -
D01chromosomeD01:41686306..41686442 -
Dt_chr2chromosomeDt_chr2:19439998..19440134 -
D10_01chromosomeD10_01:18911676..18911818 +
Chr5chromosomeChr5:3624362..3624502 +
D5_01chromosomeD5_01:38534334..38534473 -
CM018215.1chromosomeCM018215.1:43582568..43582710 -
D01chromosomeD01:44778708..44778844 -
Germplasm
Stock NameType
Acala Maxxacultivar
Sequence
>MUSB1267 ID=MUSB1267|Name=MUSB1267|organism=Gossypium hirsutum|type=genetic_marker|length=137bp
TCATGGTGACACATGGCAGTCTCATATTTTGACACGTGGAAAAAAATTAT
TATTATTTTTAAATTTTTTTTTTCATTTGTCAAAATGTGATGTTGCCACC
TACCATCATGCTATTAGCCGTCAGTGCTATGTTCATG