MUCS0373

Marker Overview
NameMUCS0373
AliasMUCS373
Genbank IDN/A
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8401
Source TypeEST
Repeat MotifTTC(4)TC(4)
PCR ConditionAnnealing temperature: 55
Primer 1MUCS373_F: GAAGCAACTTCTTGTGCTTGG
Primer 2MUCS373_R: CATAAGGAGGACGAGCTTGG
Product Length242
ContactUlloa, Mauricio
CommentPrimer data obtained in 2007-11
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Yumian-1 x T586, RIL (2006)YT-RIL_chr16-2N/AAD_chr.1657.1MUCS373View
2Yumian-1 x T586, RIL (2015)YT-RIL.15_chr16N/AAD_chr.1694.7MUCS373View
3CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr16N/AAD_chr.16208.3MUCS373View
4Yumian-1 x T586, RIL (2009)YT-RIL_chr16-2N/AAD_chr.1625.8MUCS373/150yView
5CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr16N/ADt.07153.87MUCS373-153.869View
Contact
NameDetails
Ulloa, Mauricio
Description:Breeding, genetics, and Genomics
First name:Mauricio
Last name:Ulloa
Title:Research Geneticist
Institution:USDA-ARS, W.I.C.S., Res. Unit
Address:17053 N. Shafter Ave., Shafter, California 93263
Country:United States
Email:mauricio.ulloa@ars.usda.gov
Phone:661-746-8009
Fax:746-746-1619
Keywords:Breeding and Genomics
Last update:27-Apr-2010
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
MUCS373_FMUCS373_FGossypium arboreumprimer
MUCS373_RMUCS373_RGossypium arboreumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
MUCS373MUCS373Gossypium arboreummarker_locus
MUCS373/150yMUCS373/150yGossypium arboreummarker_locus
MUCS373MUCS373-153.869Gossypium arboreummarker_locus


Germplasm
Stock NameType
AKA 8401TBD
Sequence
>MUCS0373 ID=MUCS0373|Name=MUCS0373|organism=Gossypium arboreum|type=genetic_marker|length=242bp
GAAGCAACTTCTTGTGCTTGGACTTAGCAATCTTCTTCAAAGTATTAGGA
TTAGTAATCTTCTGAAACTTAGTTCCAGACCTCAATATGTTCTCTTTCTT
CTTCTTCTCTCTCTCCTCTCTCTTCTTTCTCTTCTCCACCTTATTTTGCC
GGATCTCTTCCTTCAACTCATTAATCCTCTCTCTATAAGCTCTCTTGATC
TCCTTTTGCCTCTCCCTCTCCTCCAAGCTCGTCCTCCTTATG