MUCS0023

Marker Overview
NameMUCS0023
AliasMUCS023
Genbank IDN/A
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8401
Source TypeEST
Repeat MotifGAC(5)GAG(2)
PCR ConditionAnnealing temperature: 55
Primer 1MUCS023_F: GAGATGAAGGTGATGAAGAGGG
Primer 2MUCS023_R: GAAGCTTTCACTTCGTGTCACC
Product Length170
ContactUlloa, Mauricio
CommentPrimer data obtained in 2007-11
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_chr10N/AAD_chr.1089.6MUCS023bView
2AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr10N/AAD_chr.10236mucs0023View
3Yumian-1 x T586, RIL (2006)YT-RIL_chr10-2N/AAD_chr.1051MUCS023View
4Yumian-1 x T586, RIL (2015)YT-RIL.15_chr20N/AAD_chr.2028.1MUCS023View
5CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr20N/AAD_chr.2027.7MUCS023View
6Yumian-1 x T586, RIL (2009)YT-RIL_chr10-1N/AAD_chr.1051MUCS023/220yView
7CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr03N/AAt.0322.45MUCS023-22.452View
Contact
NameDetails
Ulloa, Mauricio
Description:Breeding, genetics, and Genomics
First name:Mauricio
Last name:Ulloa
Title:Research Geneticist
Institution:USDA-ARS, W.I.C.S., Res. Unit
Address:17053 N. Shafter Ave., Shafter, California 93263
Country:United States
Email:mauricio.ulloa@ars.usda.gov
Phone:661-746-8009
Fax:746-746-1619
Keywords:Breeding and Genomics
Last update:27-Apr-2010
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
MUCS023_FMUCS023_FGossypium arboreumprimer
MUCS023_RMUCS023_RGossypium arboreumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
MUCS023bMUCS023bGossypium arboreummarker_locus
mucs0023mucs0023Gossypium arboreummarker_locus
MUCS023MUCS023Gossypium arboreummarker_locus
MUCS023/220yMUCS023/220yGossypium arboreummarker_locus
MUCS023MUCS023-22.452Gossypium arboreummarker_locus


Germplasm
Stock NameType
AKA 8401TBD
Sequence
>MUCS0023 ID=MUCS0023|Name=MUCS0023|organism=Gossypium arboreum|type=genetic_marker|length=170bp
GAGATGAAGGTGATGAAGAGGGTAAAGATGATGATGATGACTCTGATGAT
GATCAAGACGATGATGATGATGAGGACGACGACGACGACGAGGAGGACTA
AATCACTTAACAGCCTTAAATCATGGTAGTTGCTTCTCTTGCTCAAAGGG
TGACACGAAGTGAAAGCTTC