MGHES0073

Marker Overview
NameMGHES0073
AliasNAU0490
MGHES73
MGHES-73
MGHES-073
Genbank IDAI728199
TypeSSR
SpeciesGossypium hirsutum
GermplasmAcala Maxxa
Source SequenceAI728199.1
Source TypeEST
Repeat Motif(ATTC)5; (TCC)3
PCR ConditionAnnealing temperature: 55
Primer 1MGHES73_F: CCCGATATCCTTAGCCTTTT
Primer 2MGHES73_R: AGTCGGAGGTGATGGTTAGG
Product Length210
Publication[view all]
CommentPrimer data obtained in 2005
References
External references for this genetic_marker
DatabaseAccession
DB:genbankAI728199
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_chr09N/AAD_chr.0964.6MGHES73View
2Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr09N/AAD_chr.09118.33MGHES73View
3Yumian-1 x T586, RIL (2006)YT-RIL_chr09-1N/AAD_chr.095.6MGHES73View
4Yumian-1 x T586, RIL (2015)YT-RIL.15_chr09N/AAD_chr.0976.5MGHES73View
5CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr09N/AAt.09118.1MGHES73View
6CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr09N/AAD_chr.0964.1MGHES73View
7CCRI-36 x G2005, RIL (2016)CG-RIL_chr09N/AAD_chr.0941.01MGHES73View
8Deltapine-61 x Texas-701, F2 (2007)Deltapine-61 x Texas-701, F2 (2007).DT-F2_chr.09N/AAD_chr.093.4MGHES73-208View
9Handan-208 x Pima-90, F2:3 (2007)Handan-208 x Pima-90, F2:3 (2007).HP-F2:3_chr09N/AAD_chr.0985.1MGHES73bView
10Handan-208 x Pima-90, F2:3 (2007)Handan-208 x Pima-90, F2:3 (2007).HP-F2:3_chr09N/AAD_chr.0991.4MGHES73aView
11AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr09N/AAD_chr.09146mghes0073View
12Yumian-1 x T586, RIL (2009)YT-RIL_chr09-2N/AAD_chr.095.6MGHES73/205t(C9)View
13W10 x TM-1, F2:3 (2015)WT-F2:3_chr09-1N/AAD_chr.0937MGHES-73View
14CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr09N/AAt.0994.16MGHES73-94.156View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
MGHES73_FMGHES73_FGossypium hirsutumprimer
MGHES73_RMGHES73_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
MGHES73MGHES73Gossypium hirsutummarker_locus
MGHES73-208MGHES73-208Gossypium hirsutummarker_locus
MGHES73bMGHES73bGossypium hirsutummarker_locus
MGHES73aMGHES73aGossypium hirsutummarker_locus
mghes0073mghes0073Gossypium hirsutummarker_locus
MGHES73/205t(C9)MGHES73/205t(C9)Gossypium hirsutummarker_locus
MGHES-73MGHES-73Gossypium hirsutummarker_locus
MGHES73MGHES73-94.156Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
AI728199.1AI728199.1Gossypium hirsutumsequence_feature


Publications
YearPublication
2004EST-SSR: A new class of genetic markers in cotton.
Germplasm
Stock NameType
Acala Maxxacultivar
Sequence
>MGHES0073 ID=MGHES0073|Name=MGHES0073|organism=Gossypium hirsutum|type=genetic_marker|length=215bp
CCCGATATCCTTAGCCTTTTAAATTCATTCATTCATTCATTCACTTCCTC
TAGTTTCGTTTCCGTCCAACGTAACTACCACGCCGACCGTCGTAACCACC
GCCGTAAATTCTCCCAAAATGGCGAAACTACCCTTACAGATCCTCCTCCT
CTTCCTCCTTTCCCTCATTTCCTCCTCCACCGCAGAGATCAAAACCCTAA
CCATCACCTCCGACT