MGHES0018

Marker Overview
NameMGHES0018
AliasECU-E4149
MGHES18
MGHES-18
MGHES-018
MGHES0018=ECU-E4149
Genbank IDAI729781
TypeSSR
SpeciesGossypium hirsutum
GermplasmAcala Maxxa
Source Sequencecontig(AI725573,AI729781)
Source TypeEST
Repeat Motif(AT)13
PCR ConditionAnnealing temperature: 55
Primer 1MGHES18_F: GCCATCAATTGGTGAAGCAT
Primer 2MGHES18_R: ATGCCTCGGTGAGAAAATTG
Product Length204
Publication[view all]
CommentPrimer data obtained in 2005
References
External references for this genetic_marker
DatabaseAccession
DB:genbankAI725573
DB:genbankAI729781
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1GX1135 x GX100-2, RIL (2015)GG-RIL.15_chr06N/AAD_chr.0635.1MGHES18View
2GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr06N/AAD_chr.0681.2MGHES18View
30-153 x sGK9708, RIL (2016)0s-RIL_chr06-1N/AAD_chr.0661.3MGHES18View
4GX1135 x VGX100-2, RIL (2016)GVG-RIL_chr06N/AAD_chr.0684MGHES18View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
MGHES18_FMGHES18_FGossypium hirsutumprimer
MGHES18_RMGHES18_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber lengthqUHML.0s-RIL_ch06-1.zz10Gossypium hirsutumQTL
micronaireqMIC.0s-RIL_ch06-1.ay09.5Gossypium hirsutumQTL


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
contig(AI725573,AI729781)contig(AI725573,AI729781)Gossypium hirsutumsequence_feature


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
MGHES18MGHES18Gossypium hirsutummarker_locus


Publications
YearPublication
2004EST-SSR: A new class of genetic markers in cotton.
Germplasm
Stock NameType
Acala Maxxacultivar
Sequence
>MGHES0018 ID=MGHES0018|Name=MGHES0018|organism=Gossypium hirsutum|type=genetic_marker|length=204bp
GCCATCAATTGGTGAAGCATTAAATTAAAACTGAAAGTGATTGATAAAAT
GGTTGAAAATGGCATGCTTGAAATACATGAATAAACACTCAAAACAATGA
AACAAAACATGTCAAAAGTATTATTAAAGTAAAAATACATATATATATAT
ATATATATATATATAAATTGCCTAATTAAGCTTTCAATTTTCTCACCGAG
GCAT