JESPR0241

Marker Overview
NameJESPR0241
AliasJESPR241
Genbank IDAF351479
TypeSSR
SpeciesGossypium hirsutum
GermplasmTamcot Sphinx
Source SequenceAF351479.1
Source Typegenomic
Repeat Motif(GA)16
Primer 1JESPR0241_F: CTTACCCAATTGACCTATG
Primer 2JESPR0241_R: GATTCTTCTTATCATCCCC
PolymorphismP_ JESPR0241
Publication[view all]
CommentPrimer data obtained in 2002
References
External references for this genetic_marker
DatabaseAccession
DB:genbankAF351479
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_chr05N/AAD_chr.0598.4JESP241View
2Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c05N/AAD_chr.0564.08JESPR241View
3Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch05N/AAD_chr.0555.06JESPR241View
4Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr05N/AAD_chr.0570JESPR241View
5TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c05N/AAD_chr.05105.25JESPR241View
6TM-1 x 3-79, RIL (2014)T3-RIL.14_chr05N/AAD_chr.0593.6JESPR241View
7W10 x TM-1, F2:3 (2015)WT-F2:3_chr05-1N/AAD_chr.0512.7JESPR241View
8CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr05N/AAt.05155.1JESPR241View
9HS-46 x MARCABUCAG8US-1-88, RIL (2009)HS-46 x MARCABUCAG8US-1-88, RIL (2009).HSM-RIL_chr05N/AAD_chr.058JESPR241-195View
10AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr05N/AAD_chr.05154jespr0241View
11TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.05N/AAD_chr.0593.64JESPR241-93.637View
12PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr05N/AAt.05180.7JESPR241-180.7View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
JESPR0241_FJESPR0241_FGossypium hirsutumprimer
JESPR0241_RJESPR0241_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
JESP241JESP241Gossypium hirsutummarker_locus
JESPR241JESPR241Gossypium hirsutummarker_locus
JESPR241-195JESPR241-195Gossypium hirsutummarker_locus
jespr0241jespr0241Gossypium hirsutummarker_locus
JESPR241JESPR241-93.637Gossypium hirsutummarker_locus
JESPR241JESPR241-180.7Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
AF351479.1AF351479.1Gossypium hirsutumsequence_feature


Germplasm
Stock NameType
Tamcot SphinxTBD
Sequence
>JESPR0241 ID=JESPR0241|Name=JESPR0241|organism=Gossypium hirsutum|type=genetic_marker|length=195bp
CTTACCCAATTGACCTATGTTTCTTTAAGTATGTTTGCCTTCAAATTTCT
ACNGTTNNNNAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAAGAGCCT
CNAGATTTTGCATGGGGTTTTGGTATTGAAACTAAAAAAATTAAATTAGA
ATTAAAAAAACAGTAGGTGTNNTTAAGGGGATGATAAGAAGAATC