JESPR0153

Marker Overview
NameJESPR0153
AliasJESPR153
Genbank IDAF351391
TypeSSR
SpeciesGossypium hirsutum
GermplasmTamcot Sphinx
Source SequenceAF351391.1
Source Typegenomic
Repeat Motif(CTA)18
Primer 1JESPR0153_F: GATTACCTTCATAGGCCACTG
Primer 2JESPR0153_R: GAAAACATGAGCATCCTGTG
PolymorphismP_ JESPR0153
Publication[view all]
CommentPrimer data obtained in 2002
References
External references for this genetic_marker
DatabaseAccession
DB:genbankAF351391
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1MGG-293-793, MAGIC (2018)MAGIC-19831_chr18N/AAD_chr.1867.2JESPR153-67.2View
2Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr18N/AAD_chr.1883.95JESPR153View
3Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c13N/AAD_chr.1376.41JESPR153View
4Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c18N/AAD_chr.1876.81JESPR153View
5Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch13/lgA01N/AAD_chr.1331.39JESPR153View
6H18 x 3-79, F2 (2005)H18P379-F2_chr18N/AAD_chr.1877.5JESPR153View
7H18 x TM-1, F2 (2005)H18TM1-F2_chr13N/AAD_chr.13100.6JESPR153View
8DH962 x Jinmian-6, F2 (2009)DJ-F2_chr13N/AAD_chr.1364JESPR153View
9DH962 x Jinmian-6, F2 (2009)DJ-F2_chr13/LG10N/AAD_chr.1364JESPR153View
10HS427-10 x TM-1, F2:3 (2005)HT-F2:3_chr18N/AAD_chr.185.7JESPR153View
11PD6992 x SM3, F2:3 (2005)PDSM-F2:3_chr18N/AAD_chr.1817JESPR153View
12DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr13-1N/AAD_chr.1337.4JESPR153View
13DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr13-1N/AAD_chr.13-120.4JESPR153View
14CCRI-36 x G2005, RIL (2016)CG-RIL_chr13N/AAD_chr.1362.34JESPR153View
15Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr13/lgA01N/AAD_chr.13117.9JESPR153aView
16Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr18N/AAD_chr.1870JESPR153aView
17TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c18N/AAD_chr.1847JESPR153aView
18(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr18N/AAD_chr.1829.3JESPR153aView
19Yumian-1 x 7235, RIL (2015)Y7-RIL_chr18N/AAD_chr.1824.1JESPR153aView
20TM-1 x 3-79, RIL (2014)T3-RIL.14_chr18N/AAD_chr.1847.8JESPR153aView
21TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr13N/AAD_chr.1373.9JESPR153aView
22CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr18N/AAD_chr.1893.3JESPR153aView
23Handan-208 x Pima-90, F2:3 (2007)Handan-208 x Pima-90, F2:3 (2007).HP-F2:3_chr18N/AAD_chr.1874.3JESPR153bView
24Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr13N/AAD_chr.1390JESPR153bView
25TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c13N/AAD_chr.1375JESPR153bView
26Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr18N/AAD_chr.1891.7JESPR153bView
27Yumian-1 x 7235, RIL (2015)Y7-RIL_chr13N/AAD_chr.1320JESPR153bView
28TM-1 x 3-79, RIL (2014)T3-RIL.14_chr13N/AAD_chr.1370.6JESPR153bView
29TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr18N/AAD_chr.1847.4JESPR153bView
30CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr13N/AAD_chr.1393.3JESPR153bView
31Handan-208 x Pima-90, F2:3 (2007)Handan-208 x Pima-90, F2:3 (2007).HP-F2:3_chr13/lgA01N/AAD_chr.13117.8JESPR153cView
32Handan-208 x Pima-90, F2:3 (2007)Handan-208 x Pima-90, F2:3 (2007).HP-F2:3_chr20N/AAD_chr.20151.8JESPR153cView
33AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr18N/AAD_chr.1846jespr0153View
34AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr13N/AAD_chr.13175jespr0153View
35TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr13/A13N/AAD_chr.1363.05JESPR153-130View
36TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr13N/AAD_chr.1363.5JESPR153-130View
37Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_chr18N/AAD_chr.1852.2JESPR153-100View
38TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr18N/AAD_chr.1865.2JESPR153-100View
39TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr18/D13N/AAD_chr.1865.82JESPR153-100View
40Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_lgA01N/AAD_chr.1322.3JESPR153-128View
41Xinluzao-1 x Hai-7124, F2 (2008)Xinluzao-1 x Hai-7124, F2 (2008).XH-F2_lg22/chr13N/AAD_chr.1370.4JESPR153-2View
42CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr13N/AAt.1338.57JESPR153b-38.57View
43CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr18N/ADt.1352.96JESPR153-52.956View
44TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.13N/AAD_chr.1370.58JESPR153b-70.575View
45TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.18N/AAD_chr.1847.76JESPR153a-47.759View
46PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr18N/ADt.13173.1JESPR153-173.1View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
JESPR0153_FJESPR0153_FGossypium hirsutumprimer
JESPR0153_RJESPR0153_RGossypium hirsutumprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
seed cotton weight per bollqBWT.TTT-CSIL_ch18.sy15.1Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
JESPR153JESPR153-67.2Gossypium hirsutummarker_locus
JESPR153JESPR153Gossypium hirsutummarker_locus
JESPR153aJESPR153aGossypium hirsutummarker_locus
JESPR153bJESPR153bGossypium hirsutummarker_locus
JESPR153cJESPR153cGossypium hirsutummarker_locus
jespr0153jespr0153Gossypium hirsutummarker_locus
JESPR153-130JESPR153-130Gossypium hirsutummarker_locus
JESPR153-100JESPR153-100Gossypium hirsutummarker_locus
JESPR153-128JESPR153-128Gossypium hirsutummarker_locus
JESPR153-2JESPR153-2Gossypium hirsutummarker_locus
JESPR153bJESPR153b-38.57Gossypium hirsutummarker_locus
JESPR153JESPR153-52.956Gossypium hirsutummarker_locus
JESPR153bJESPR153b-70.575Gossypium hirsutummarker_locus
JESPR153aJESPR153a-47.759Gossypium hirsutummarker_locus
JESPR153JESPR153-173.1Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
AF351391.1AF351391.1Gossypium hirsutumsequence_feature


Germplasm
Stock NameType
Tamcot SphinxTBD
Sequence
>JESPR0153 ID=JESPR0153|Name=JESPR0153|organism=Gossypium hirsutum|type=genetic_marker|length=129bp
GATTACCTTCATAGGCCACTGTGACGTTGCCTCTACTACTACTACTACTA
CTACTACTACTACTACTACTACTACTACTACTACTACATCAATGGAGATC
CCCAGCTCCCACAGGATGCTCATGTTTTC