JESPR0058

Marker Overview
NameJESPR0058
AliasJESPR058
Genbank IDAF351297
TypeSSR
SpeciesGossypium hirsutum
GermplasmTamcot Sphinx
Source Typegenomic
Repeat Motif(CTT)10
Primer 1JESPR0058_F: CCGCCCTTCTCTTGCTTAGATCTGG
Primer 2JESPR0058_R: GGAGCCAATTGAGAAGTGAATCCAA
Publication[view all]
CommentPrimer data obtained in 2002
References
External references for this genetic_marker
DatabaseAccession
DB:genbankAF351297
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
17235 x TM-1, RIL (2007)7235 x TM-1, RIL (2007).7T-RIL_A03N/AAD_chr.030JESPR58View
2Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008)Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008).JZ-F2_A08N/AA_chr.08163.3JESPR58View
37235 x TM-1, F2:3 (2005)7T-F2:3_chr03N/AAD_chr.030JESPR58View
4HS427-10 x TM-1, F2:3 (2005)HT-F2:3_chr03-2N/AAD_chr.0368.2JESPR58View
5PD6992 x SM3, F2:3 (2005)PDSM-F2:3_chr03-1N/AAD_chr.030JESPR58View
6AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr03N/AAD_chr.0377jespr0058View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
JESPR0058_FJESPR0058_FGossypium hirsutumprimer
JESPR0058_RJESPR0058_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
lint percentqLP.7T-ch3.e2Gossypium hirsutumQTL
lint percentqLP.7T-ch3.e3Gossypium hirsutumQTL
lint percentqLP.7T-ch3.e4Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
JESPR58JESPR58Gossypium hirsutummarker_locus
jespr0058jespr0058Gossypium hirsutummarker_locus


Germplasm
Stock NameType
Tamcot SphinxTBD