HAU0008

Marker Overview
NameHAU0008
AliasHAU008
Genbank IDEE593140
TypeSSR
SpeciesGossypium barbadense
Germplasm3-79
Source TypeEST
Repeat Motif(AAC)6
Primer 1HAU0008_F: TCAACATCTCACCAACAAGC
Primer 2HAU0008_R: CATACTTGCAATTAGGACAAGC
Product Length207
Publication[view all]
ContactZhang, Xian-Long
CommentPrimer data obtained in 2007-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankEE593140
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c14N/AAD_chr.14120.79HAU008View
2TM-1 x 3-79, RIL (2014)T3-RIL.14_chr14N/AAD_chr.145.6HAU008View
30-153 x sGK9708, RIL (2016)0s-RIL_chr14-1N/AAD_chr.1427HAU008View
40-153 x sGK9708, RIL (2017)0s-RIL.17_chr14N/AAD_chr.14153.49HAU008View
5CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr14N/AAD_chr.1462.8HAU0008View
6CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr14N/ADt.0212.86HAU0008-12.86View
7TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.14N/AAD_chr.145.63HAU008-5.627View
Contact
NameDetails
Zhang, Xian-Long
Description:Genomics breeding
First name:Xian-Long
Last name:Zhang
Title:Professor
Institution:College of Plant Science and Technology, Huazhong Agricultural University
Address:#1 Shizishan, Wuhan, Hubei 430070
Country:China
Email:xlzhang@mail.hzau.edu.cn
Phone:+86 27 87280510
Fax:+86 27 87280016
Last update:12-Jun-2009
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
HAU0008_FHAU0008_FGossypium barbadenseprimer
HAU0008_RHAU0008_RGossypium barbadenseprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
HAU008HAU008Gossypium barbadensemarker_locus
HAU0008HAU0008Gossypium barbadensemarker_locus
HAU0008HAU0008-12.86Gossypium barbadensemarker_locus
HAU008HAU008-5.627Gossypium barbadensemarker_locus


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chr05chromosomeHAU0008:1..207 .
Chr05:1345948..1346148 -
Germplasm
Stock NameType
3-79TBD
Sequence
>HAU0008 ID=HAU0008|Name=HAU0008|organism=Gossypium barbadense|type=genetic_marker|length=207bp
TCAACATCTCACCAACAAGCTCCAATGGCTCGGAACATTTCAATGGCGGT
TCGATCTCCAGTGAGGACTCGAACAACAACAACAACAACAAGCAGCAACA
ACAACATTTTTCAAGCACCACTAACATGGTGGCTTTGGCATGTTTAAATT
GTCATCTTCTTGTAATCCTCCCCAAATCCTCCCCTGCTTGTCCTAATTGC
AAGTATG