Gh501

Marker Overview
NameGh501
Genbank IDDQ908440
TypeSSR
SpeciesGossypium hirsutum
GermplasmTamcot Sphinx
Source SequenceDQ908440
Source Typegenomic
Repeat MotifAGA(21)
Primer 1Gh501_F: CACAAATTGAAAGATACCCAGATCTTC
Primer 2Gh501_R: TTCCTCATTCCCGTTCGATTTCAG
Publication[view all]
CommentPrimer data obtained in 2008-01 from Hoffman, Steve M.
References
External references for this genetic_marker
DatabaseAccession
DB:genbankDQ908440
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr13N/AAD_chr.1394.33Gh501bView
2(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr18N/AAD_chr.1849.9Gh501bView
3TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c18N/AAD_chr.1870.89GH501View
4Yumian-1 x T586, RIL (2015)YT-RIL.15_chr18N/AAD_chr.1848.1GH501View
5Yumian-1 x 7235, RIL (2015)Y7-RIL_chr24N/AAD_chr.2424.5GH501View
6DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr25-1N/AAD_chr.2565.96GH501View
7TM-1 x 3-79, RIL (2014)T3-RIL.14_chr18N/AAD_chr.1871.6GH501View
8GX1135 x GX100-2, F2 (2013)GG-F2_chr18-1N/AAD_chr.180GH501View
9GX1135 x GX100-2, RIL (2015)GG-RIL.15_chr18-1N/AAD_chr.182.6GH501View
10GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr18-1N/AAD_chr.182.6GH501View
11DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_LG3N/Aunknown19GH501View
12CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr18N/AAD_chr.1835.2GH501View
13(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr24N/AAD_chr.2445.4Gh501aView
14CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr18N/ADt.1367.29Gh501-67.294View
15TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.18N/AAD_chr.1871.63GH501-71.627View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Gh501_FGh501_FGossypium hirsutumprimer
Gh501_RGh501_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Gh501bGh501bGossypium hirsutummarker_locus
GH501GH501Gossypium hirsutummarker_locus
Gh501aGh501aGossypium hirsutummarker_locus
Gh501Gh501-67.294Gossypium hirsutummarker_locus
GH501GH501-71.627Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DQ908440DQ908440Gossypium hirsutumsequence_feature


Germplasm
Stock NameType
Tamcot SphinxTBD
Sequence
>Gh501 ID=Gh501|Name=Gh501|organism=Gossypium hirsutum|type=genetic_marker|length=205bp
CACAAATTGAAAGATACCCAGATCTTCATTTTGAAAAAAAATGTTAAAGA
TCAAAGATCTGATAGGAAAAAATAAAGAAGAAAAATGGAAGATATAAAAA
GGAAAAAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAA
GAAGAAGAAGAAGAAAAAGAAGAGAAAATACCTGAAATCGAACGGGAATG
AGGAA