Gh156

Marker Overview
NameGh156
Genbank IDDQ908098
TypeSSR
SpeciesGossypium hirsutum
GermplasmTamcot Sphinx
Source SequenceDQ908098
Source Typegenomic
Repeat MotifTC(10)
Primer 1Gh156_F: GATCTTGACAGGGAAGACAGACA
Primer 2Gh156_R: CATAACTTGACATCCATCCATGA
Publication[view all]
CommentPrimer data obtained in 2008-01 from Hoffman, Steve M.
References
External references for this genetic_marker
DatabaseAccession
DB:genbankDQ908098
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
10-153 x sGK9708, RIL (2016)0s-RIL_chr04N/AAD_chr.0467.6Gh156View
2CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr04N/AAt.0467.5Gh156View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Gh156_FGh156_FGossypium hirsutumprimer
Gh156_RGh156_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber elongationqFEL.0s-RIL_ch04.qz08.1Gossypium hirsutumQTL
fiber uniformityqFU.0s-RIL_ch04.qz08.2Gossypium hirsutumQTL


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DQ908098DQ908098Gossypium hirsutumsequence_feature


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Gh156Gh156Gossypium hirsutummarker_locus


Germplasm
Stock NameType
Tamcot SphinxTBD
Sequence
>Gh156 ID=Gh156|Name=Gh156|organism=Gossypium hirsutum|type=genetic_marker|length=191bp
GATCTTGACAGGGAAGACAGACAAACCTGTTTCTTTTCTCTCTCCCTCTC
ACTCTCTCTCTCTCTCTCTCTCGGGATTGGGACTTGTAAACAATAATATT
TACTTATATCCTCATGATATATATTGGGAATATATTATATCATGCATGCA
ACACATGCATACATGCATTCATGGATGGATGTCAAGTTATG