Gh048

Marker Overview
NameGh048
AliasGh48
Genbank IDDQ907990
TypeSSR
SpeciesGossypium hirsutum
GermplasmTamcot Sphinx
Source SequenceDQ907990
Source Typegenomic
Repeat MotifGAAAA(5)
Primer 1Gh048_F: CTGTTTCTTAACATGGGTTTTTTCC
Primer 2Gh048_R: CAAAACACTAATTGCAAAAATAAATTATATTTTG
PolymorphismP_ Gh048
Publication[view all]
CommentPrimer data obtained in 2008-01 from Hoffman, Steve M.
References
External references for this genetic_marker
DatabaseAccession
DB:genbankDQ907990
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr20N/AAD_chr.2088.9Gh048View
2TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c20N/AAD_chr.2032.41Gh048View
3Yumian-1 x T586, RIL (2015)YT-RIL.15_chr20N/AAD_chr.2097.7Gh048View
4TM-1 x 3-79, RIL (2014)T3-RIL.14_chr20N/AAD_chr.2033Gh048View
5CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr20N/ADt.1064.2GH48View
6TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.20N/AAD_chr.2033.01GH048-33.009View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Gh048_FGh048_FGossypium hirsutumprimer
Gh048_RGh048_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Gh048Gh048Gossypium hirsutummarker_locus
GH48GH48Gossypium hirsutummarker_locus
GH048GH048-33.009Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DQ907990DQ907990Gossypium hirsutumsequence_feature


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
CM017710.1chromosomeCM017710.1:55138165..55138260 -
CM017658.1chromosomeCM017658.1:55928229..55928319 -
CM017632.1chromosomeCM017632.1:53868979..53869074 -
D10chromosomeD10:54897361..54897456 -
Gbar_D10chromosomeGbar_D10:53907904..53907999 -
scaffold72supercontigscaffold72:107554..107649 +
D10chromosomeD10:54979027..54979117 -
D10chromosomeD10:56232712..56232802 -
Ghir_D10chromosomeGhir_D10:56282019..56282107 -
scaffold4418_D10supercontigscaffold4418_D10:10011..10101 +
Chr11chromosomeChr11:37279734..37279824 -
D5_10chromosomeD5_10:10799900..10799990 +
CM018224.1chromosomeCM018224.1:53938365..53938460 -
D10chromosomeD10:56502120..56502210 -
Chr11chromosomeGh048:1..487 .
Chr11:51923704..51924187 -
Germplasm
Stock NameType
Tamcot SphinxTBD
Sequence
>Gh048 ID=Gh048|Name=Gh048|organism=Gossypium hirsutum|type=genetic_marker|length=91bp
CTGTTTCTTAACATGGGTTTTTTCCTTAAAAGAAAAGAAAAGAAAAGAAA
AGAAAAACAAAATATAATTTATTTTTGCAATTAGTGTTTTG