DPL0897

Marker Overview
NameDPL0897
Genbank IDGQ395228
TypeSSR
SpeciesGossypium hirsutum
GermplasmDelta Opal
Source SequenceGQ395228
Source Typegenomic
PCR ConditionAnnealing temperature: 55
Primer 1DPL0897_F: ATCGTACCCAATGGAGGATG
Primer 2DPL0897_R: GCTTTCTTTCAGCTCCCTATTT
PolymorphismP_ DPL0897
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankGQ395228
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr16N/AAD_chr.16130DPL0897View
2Yumian-1 x T586, RIL (2015)YT-RIL.15_chr16N/AAD_chr.1685.5DPL0897View
3TM-1 x 3-79, RIL (2014)T3-RIL.14_chr16N/AAD_chr.1638.3DPL0897View
4TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr16N/AAD_chr.1652.9DPL0897View
5GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr16N/AAD_chr.1630.3DPL0897View
6GX1135 x VGX100-2, RIL (2016)GVG-RIL_chr16-2N/AAD_chr.160DPL0897View
7CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr16N/ADt.0761.9DPL0897View
8CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr16N/AAD_chr.16151.6DPL0897View
9CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr16N/ADt.07108.31DPL0897-108.314View
10TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.16N/AAD_chr.1638.34DPL0897-38.337View
Contact
NameDetails
Monsanto
Country:United States
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
DPL0897_FDPL0897_FGossypium hirsutumprimer
DPL0897_RDPL0897_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
DPL0897DPL0897Gossypium hirsutummarker_locus
DPL0897DPL0897-108.314Gossypium hirsutummarker_locus
DPL0897DPL0897-38.337Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
GQ395228GQ395228Gossypium hirsutumsequence_feature


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chr01chromosomeDPL0897:1..830 .
Chr01:38246007..38246806 -
Chr7chromosomeDPL0897:1..830 .
Chr7:19656221..19657020 -
Germplasm
Stock NameType
Delta OpalTBD
Sequence
>DPL0897 ID=DPL0897|Name=DPL0897|organism=Gossypium hirsutum|type=genetic_marker|length=163bp
ATCGTACCCAATGGAGGATGGAACAAATTATGAAAACCTCTTTACAATAA
TAAGTCTAAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGT
AGTAGTAGTAGTAGTTAATCCCTATAGTACAATGAACAATAAAATAGGGA
GCTGAAAGAAAGC