DPL0790

Marker Overview
NameDPL0790
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDelta Opal
Source SequenceDPL0790_orig
Source Typegenomic
PCR ConditionAnnealing temperature: 55
Primer 1DPL0790_F: ACAATGGCGGATTGGATTC
Primer 2DPL0790_R: TTCCAAGTGTCACCCTCTCAC
PolymorphismP_ DPL0790
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1W10 x TM-1, F2:3 (2015)WT-F2:3_chr08N/AAD_chr.0892MON-DPL0790View
2GX1135 x GX100-2, F2 (2013)GG-F2_chr08N/AAD_chr.0824.1DPL790View
3GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr01-1N/AAD_chr.0132.2DPL0790View
40-153 x sGK9708, RIL (2016)0s-RIL_chr15-1N/AAD_chr.1522.1DPL0790View
5GX1135 x VGX100-2, RIL (2016)GVG-RIL_chr01N/AAD_chr.01188.7DPL0790View
Contact
NameDetails
Monsanto
Country:United States
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
DPL0790_FDPL0790_FGossypium hirsutumprimer
DPL0790_RDPL0790_RGossypium hirsutumprimer


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DPL0790_origDPL0790_origGossypium hirsutumsequence_feature


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
MON-DPL0790MON-DPL0790Gossypium hirsutummarker_locus
DPL790DPL790Gossypium hirsutummarker_locus
DPL0790DPL0790Gossypium hirsutummarker_locus


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chr02chromosomeDPL0790:1..587 .
Chr02:2262584..2263174 -
Germplasm
Stock NameType
Delta OpalTBD
Sequence
>DPL0790 ID=DPL0790|Name=DPL0790|organism=Gossypium hirsutum|type=genetic_marker|length=190bp
ACAATGGCGGATTGGATTCAAAAGCCATGGAATAATATTAAAATTAATAA
TAAAAATGGAGGTAAAGAAGTAAAGAACACATGTATTTAAATAGGGGCGA
TATTTTCGTTTTGAAAGAAAAAATTACGTAAGAGAGAGAGAGAGAGAGAG
AGAGAGAGAGAGAGAGAGGGTGAGAGGGTGACACTTGGAA