DPL0760

Marker Overview
NameDPL0760
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDelta Opal
Source SequenceDPL0760_orig
Source Typegenomic
PCR ConditionAnnealing temperature: 55
Primer 1DPL0760_F: TCTGATTCTGAACCCGTGTAACTA
Primer 2DPL0760_R: GTGACACATTAACAGACAGTCAAACAG
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr08N/AAD_chr.0870DPL0760View
2TM-1 x 3-79, RIL (2014)T3-RIL.14_chr08N/AAD_chr.0893.9DPL0760View
3TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr08N/AAD_chr.0824.9DPL0760View
4CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr08N/AAD_chr.0813DPL0760View
5(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr08-3N/AAD_chr.0823.6MON_DPL0760View
6CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr08N/AAt.0897.38DPL0760-97.383View
7TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.08N/AAD_chr.0893.92DPL0760-93.922View
Contact
NameDetails
Monsanto
Country:United States
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
DPL0760_FDPL0760_FGossypium hirsutumprimer
DPL0760_RDPL0760_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
DPL0760DPL0760Gossypium hirsutummarker_locus
MON_DPL0760MON_DPL0760Gossypium hirsutummarker_locus
DPL0760DPL0760-97.383Gossypium hirsutummarker_locus
DPL0760DPL0760-93.922Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DPL0760_origDPL0760_origGossypium hirsutumsequence_feature


Germplasm
Stock NameType
Delta OpalTBD
Sequence
>DPL0760 ID=DPL0760|Name=DPL0760|organism=Gossypium hirsutum|type=genetic_marker|length=149bp
TCTGATTCTGAACCCGTGTAACTAGGTGTGTGTGTGTGTGTGTGTGTGTG
TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG
TGTGTGTGTGTGCATATCTGTTCTGTTTGACTGTCTGTTAATGTGTCAC