DPL0757

Marker Overview
NameDPL0757
Genbank IDGQ395148
TypeSSR
SpeciesGossypium hirsutum
GermplasmDelta Opal
Source SequenceGQ395148
Source Typegenomic
PCR ConditionAnnealing temperature: 55
Primer 1DPL0757_F: CCCTACAACAGTTTGATACCATGA
Primer 2DPL0757_R: ATTGAGGGTATTGCTATACATCGG
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankGQ395148
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr07-2N/AAD_chr.0753.4MON_DPL0757View
2CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr07N/AAD_chr.0731.2DPL0757View
3CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr07N/AAt.0776.9DPL0757-76.897View
Contact
NameDetails
Monsanto
Country:United States
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
DPL0757_FDPL0757_FGossypium hirsutumprimer
DPL0757_RDPL0757_RGossypium hirsutumprimer


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
GQ395148GQ395148Gossypium hirsutumsequence_feature


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
MON_DPL0757MON_DPL0757Gossypium hirsutummarker_locus
DPL0757DPL0757Gossypium hirsutummarker_locus
DPL0757DPL0757-76.897Gossypium hirsutummarker_locus


Germplasm
Stock NameType
Delta OpalTBD
Sequence
>DPL0757 ID=DPL0757|Name=DPL0757|organism=Gossypium hirsutum|type=genetic_marker|length=183bp
CCCTACAACAGTTTGATACCATGATTAAACAGTTTAGAACACACACACAC
ACACACACACACACACACACACACACACACACACACACACACACACACAC
ACACACACACACACACACACACACTTGTTTTTGCAATCTAAAGCACCTAG
AAAAAACCTCCGATGTATAGCAATACCCTCAAT