DPL0568

Marker Overview
NameDPL0568
Genbank IDGQ395061
TypeSSR
SpeciesGossypium hirsutum
GermplasmDelta Opal
Source SequenceGQ395061
Source Typegenomic
PCR ConditionAnnealing temperature: 55
Primer 1DPL0568_F: CAAGTTTGCTACTTTGGTCTCAATC
Primer 2DPL0568_R: TTACGCGTCTACATTTCAACACTC
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankGQ395061
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr02N/AAD_chr.0250DPL0568View
2TM-1 x 3-79, RIL (2014)T3-RIL.14_chr02N/AAD_chr.0248.2DPL0568View
3CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr02N/AAD_chr.0242.1DPL0568View
4CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr02N/AAt.0273.9DPL0568-73.901View
5TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.02N/AAD_chr.0248.16DPL0568-48.156View
Contact
NameDetails
Monsanto
Country:United States
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
DPL0568_FDPL0568_FGossypium hirsutumprimer
DPL0568_RDPL0568_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
50 span lengthqSL50.T3-RIL_ch2.csGossypium spp.QTL
fiber length by weightqFLW.T3-RIL_ch2.csGossypium spp.QTL
upper quartile length by weightqUQLW.T3-RIL_ch2.csGossypium spp.QTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
upper half mean lengthqUHML.CY-RIL.17_ch01.ay15Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
DPL0568DPL0568Gossypium hirsutummarker_locus
DPL0568DPL0568-73.901Gossypium hirsutummarker_locus
DPL0568DPL0568-48.156Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
GQ395061GQ395061Gossypium hirsutumsequence_feature


Germplasm
Stock NameType
Delta OpalTBD
Sequence
>DPL0568 ID=DPL0568|Name=DPL0568|organism=Gossypium hirsutum|type=genetic_marker|length=110bp
CAAGTTTGCTACTTTGGTCTCAATCTAAAATGCCAATGAGTAAGAGAGAG
AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAAGAGTGTTGAAATGT
AGACGCGTAA