DPL0554

Marker Overview
NameDPL0554
Genbank IDGQ395052
TypeSSR
SpeciesGossypium hirsutum
GermplasmDelta Opal
Source SequenceGQ395052
Source Typegenomic
PCR ConditionAnnealing temperature: 55
Primer 1DPL0554_F: ATGTACTTGTTCTCCAGTGTCGG
Primer 2DPL0554_R: TCAAGAATCTGTAAGTTGGGTCTTC
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankGQ395052
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
10-153 x sGK9708, RIL (2016)0s-RIL_chr19-1N/AAD_chr.1945.9DPL0554View
2CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr05N/AAt.0581.7DPL0554View
Contact
NameDetails
Monsanto
Country:United States
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
DPL0554_FDPL0554_FGossypium hirsutumprimer
DPL0554_RDPL0554_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber elongationqFEL.0s-RIL_ch19-1.lq08.1Gossypium hirsutumQTL
fiber elongationqFEL.0s-RIL_ch19-1.qz08Gossypium hirsutumQTL


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
GQ395052GQ395052Gossypium hirsutumsequence_feature


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
DPL0554DPL0554Gossypium hirsutummarker_locus


Germplasm
Stock NameType
Delta OpalTBD
Sequence
>DPL0554 ID=DPL0554|Name=DPL0554|organism=Gossypium hirsutum|type=genetic_marker|length=232bp
ATGTACTTGTTCTCCAGTGTCGGGGAGAATTCTTTCCCATTGATGAAAAC
TTGATTGCAACTTATCAATCTATACCAACAAAAAAAAAAAAGAAACACCC
AAAACGTCATCTAAGTGAAAATCCTAAACAAAGAAGATCAAGCAATCTCT
CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTAACAGGGTTCAAAA
AATAAATGAAGACCCAACTTACAGATTCTTGA