DPL0544

Marker Overview
NameDPL0544
Genbank IDGQ395048
TypeSSR
SpeciesGossypium hirsutum
GermplasmDelta Opal
Source SequenceGQ395048
Source Typegenomic
PCR ConditionAnnealing temperature: 55
Primer 1DPL0544_F: ACTCTTTACAGGTCCTCCTCCTTT
Primer 2DPL0544_R: CTCAACATAATGCATAACTGCCTC
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankGQ395048
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Yumian-1 x T586, RIL (2015)YT-RIL.15_chr14N/AAD_chr.1424.8DPL0544View
2CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr14N/AAD_chr.1447.8DPL0544View
3CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr14N/ADt.0237.91DPL0544-37.907View
Contact
NameDetails
Monsanto
Country:United States
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
DPL0544_FDPL0544_FGossypium hirsutumprimer
DPL0544_RDPL0544_RGossypium hirsutumprimer


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
GQ395048GQ395048Gossypium hirsutumsequence_feature


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
DPL0544DPL0544Gossypium hirsutummarker_locus
DPL0544DPL0544-37.907Gossypium hirsutummarker_locus


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chr05chromosomeDPL0544:1..248 .
Chr05:5171548..5171775 -
scaffold246supercontigDPL0544:1..248 .
scaffold246:445994..446221 +
Germplasm
Stock NameType
Delta OpalTBD
Sequence
>DPL0544 ID=DPL0544|Name=DPL0544|organism=Gossypium hirsutum|type=genetic_marker|length=143bp
ACTCTTTACAGGTCCTCCTCCTTTTTACTTATTTCATGTATGTATGTATG
TATGTATGTATGTATGTATGTATGTATGAGGATCCGTTTTTAATACCCAT
TTTTTGTTTCAGGTTGGATGAGGCAGTTATGCATTATGTTGAG