DPL0509

Marker Overview
NameDPL0509
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDelta Opal
Source SequenceDPL0509_orig
Source Typegenomic
PCR ConditionAnnealing temperature: 55
Primer 1DPL0509_F: GCAAAGATATTTACAGCTCGTGTG
Primer 2DPL0509_R: TGGTAATACTCCGTAACCCTGTTT
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1W10 x TM-1, F2:3 (2015)WT-F2:3_chr08N/AAD_chr.0819.2MON-DPL0509View
20-153 x sGK9708, RIL (2016)0s-RIL_chr15-2N/AAD_chr.1521.1DPL0509View
3CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr15N/ADt.0178.9DPL0509View
4CCRI-36 x G2005, RIL (2016)CG-RIL_chr15N/AAD_chr.15123.7DPL0509View
Contact
NameDetails
Monsanto
Country:United States
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
DPL0509_FDPL0509_FGossypium hirsutumprimer
DPL0509_RDPL0509_RGossypium hirsutumprimer


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DPL0509_origDPL0509_origGossypium hirsutumsequence_feature


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
MON-DPL0509MON-DPL0509Gossypium hirsutummarker_locus
DPL0509DPL0509Gossypium hirsutummarker_locus


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chr02chromosomeDPL0509:1..728 .
Chr02:43298938..43299604 -
Germplasm
Stock NameType
Delta OpalTBD
Sequence
>DPL0509 ID=DPL0509|Name=DPL0509|organism=Gossypium hirsutum|type=genetic_marker|length=222bp
GCAAAGATATTTACAGCTCGTGTGATAATCTCTATCCTGAGTATTTGAGG
TTAATTTATTATAGTGTATGTATGTATGTATGTATGTATGTATGTATGTA
TGTATGTATGTATATATGTATGTATGTATGTATGTAGGTATGTACGTATG
TATGTATGTATGTAAATATGTAACACCCCTAACTCGCATTTGACGCCAAA
ACAGGGTTACGGAGTATTACCA