DPL0489

Marker Overview
NameDPL0489
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDelta Opal
Source SequenceDPL0489_orig
Source Typegenomic
Repeat Motif(ATAC)10
PCR ConditionAnnealing temperature: 55
Primer 1DPL0489_F: ACTCCTCCTTGCTCATGTTGAATA
Primer 2DPL0489_R: CATGGATGACTCTTCTGCTTCATA
PolymorphismP_ DPL0489
ContactFang, David D.
CommentPrimer data obtained in 2007-05
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr22N/ADt.0481.1DPL0489-81.1View
2TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c22N/AAD_chr.2224.07DPL0489View
3Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr22N/AAD_chr.2282.77DPL0489View
4AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr22N/AAD_chr.2285DPL0489View
5Yumian-1 x T586, RIL (2006)YT-RIL_chr22N/AAD_chr.2221.5DPL0489View
6Yumian-1 x T586, RIL (2015)YT-RIL.15_chr22N/AAD_chr.2242.2DPL0489View
7TM-1 x 3-79, RIL (2014)T3-RIL.14_chr22N/AAD_chr.2258.6DPL0489View
80-153 x sGK9708, RIL (2016)0s-RIL_chr22-2N/AAD_chr.222.4DPL0489View
9CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr13N/AAt.1393.2DPL0489View
10CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr22N/ADt.0471.8DPL0489View
11Yumian-1 x T586, RIL (2009)YT-RIL_chr22N/AAD_chr.2274.2DPL0489/190yView
12TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.22N/AAD_chr.2258.58DPL0489-58.579View
Contact
NameDetails
Fang, David D.
Description:Molecular markers, fiber development
First name:David
Last name:Fang
Title:Supervisory Research Geneticist
Institution:USDA-ARS-SRRC-CFBRU
Address:1100 Robert E. Lee Blvd, New Orleans, LA 70124
Country:United States
Email:david.fang@ars.usda.gov
Phone:504 286 4527
Fax:001662686-5218
Keywords:Structural Genomics
Last update:2-Jul-2009
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
DPL0489_FDPL0489_FGossypium hirsutumprimer
DPL0489_RDPL0489_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
DPL0489DPL0489-81.1Gossypium hirsutummarker_locus
DPL0489DPL0489Gossypium hirsutummarker_locus
DPL0489/190yDPL0489/190yGossypium hirsutummarker_locus
DPL0489DPL0489-58.579Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DPL0489_origDPL0489_origGossypium hirsutumsequence_feature


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chr09chromosomeDPL0489:1..404 .
Chr09:66134734..66135113 +
Chr12chromosomeDPL0489:1..404 .
Chr12:11680738..11681117 +
Germplasm
Stock NameType
Delta OpalTBD
Sequence
>DPL0489 ID=DPL0489|Name=DPL0489|organism=Gossypium hirsutum|type=genetic_marker|length=188bp
ACTCCTCCTTGCTCATGTTGAATATCAAACACTCTTCTATAAGATGATGC
ACCTGCATAAATACATACATACATACATACATACATACATACATACATAC
ATGATCATCTTGGAAACAACTATAACTTTATGGAAATTGCTATATAATAC
TTACCATATGGATGTATGAAGCAGAAGAGTCATCCATG