DC40229, DC40229 (genetic_marker) Gossypium hirsutum

Marker Overview
NameDC40229
Genbank IDGQ394680
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceMONCS1703
Source Typegenomic
Primer 1DC40229_F: ACTTTTTCCAATTTGATCTCTC
Primer 2DC40229_R: CGTGTTCAAGTGTGCTGA
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
Germplasm
Stock NameType
Deltapine 90TBD
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
DC40229_FDC40229_FGossypium hirsutumprimer
DC40229_RDC40229_RGossypium hirsutumprimer


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
MONCS1703MONCS1703Gossypium hirsutumsequence_feature


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
MON_DC40229aMON_DC40229aGossypium hirsutummarker_locus
DC40229DC40229Gossypium hirsutummarker_locus
DC40229aDC40229aGossypium hirsutummarker_locus
DC40229bDC40229bGossypium hirsutummarker_locus
DC40229DC40229-86.122Gossypium hirsutummarker_locus


Contact
NameDetails
Monsanto
Country:United States
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D08chromosomeD08:61732332..61732518 +
A08chromosomeA08:115563704..115563910 +
CM018222.1chromosomeCM018222.1:58120664..58120850 +
CM018209.1chromosomeCM018209.1:110850667..110850873 +
D5_08chromosomeD5_08:54331118..54331303 +
scaffold245supercontigscaffold245:648487..648673 -
D10_08chromosomeD10_08:6847568..6847753 -
scaffold1048.1supercontigscaffold1048.1:536024..536210 +
D08chromosomeD08:58434547..58434733 +
scaffold5391supercontigscaffold5391:6396..6602 -
scaffold5391supercontigscaffold5391:4472..4678 -
Ghir_D08chromosomeGhir_D08:60992589..60992775 +
D08chromosomeD08:61536294..61536480 +
A08chromosomeA08:116986624..116986830 +
D08chromosomeD08:60828986..60829172 +
A08chromosomeA08:116951383..116951589 +
D08chromosomeD08:58101531..58101717 +
Dt08chromosomeDt08:60821442..60821628 +
At08chromosomeAt08:100444624..100444830 +
scaffold17533supercontigscaffold17533:4136..4322 +
scaffold16236supercontigscaffold16236:77748..77954 +
Gbar_D08chromosomeGbar_D08:58167813..58167999 +
Gbar_A08chromosomeGbar_A08:111544732..111544938 +
D08chromosomeD08:60070129..60070315 +
A08chromosomeA08:112601610..112601816 +
CM017630.1chromosomeCM017630.1:59660336..59660522 +
CM017617.1chromosomeCM017617.1:111036493..111036699 +
CM017656.1chromosomeCM017656.1:61861650..61861835 +
CM017643.1chromosomeCM017643.1:120501912..120502118 +
CM017708.1chromosomeCM017708.1:58443457..58443643 +
CM017695.1chromosomeCM017695.1:111655699..111655905 +
Sequence
>DC40229 ID=DC40229|Name=DC40229|organism=Gossypium hirsutum|type=genetic_marker|length=187bp
ACTTTTTCCAATTTGATCTCTCTACTTTTGAGTCTAATATTAAATGCATA
ATATACGTAATTTATGGTTAAAATTTATTGTATTTTGAACTTCTATATAT
GCAAAATATGATTTTTAATTTTTATTTTTTTATACAATGCCTAACCCTTA
AATAAGAGGATAACGCGCTTCAGCACACTTGAACACG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr08-3N/AAD_chr.0859.4MON_DC40229aView
2CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr24N/AAD_chr.2422.8DC40229View
3Yumian-1 x 7235, RIL (2015)Y7-RIL_chr08N/AAD_chr.0833.2DC40229aView
4Yumian-1 x 7235, RIL (2015)Y7-RIL_chr24N/AAD_chr.248.5DC40229bView
5CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr24N/ADt.0886.12DC40229-86.122View
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankGQ394680