trnC-GCA, trnC-GCA (gene) Gossypium herbaceum

Gene Overview
Name trnC-GCA
Gene Symbol trnC-GCA
Type gene
Organism Gossypium herbaceum
Synonym NA
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Name Genome Location NCBI Accession
NC_023215.1-trnC-GCA N/A NC_023215.1
NC_016692.1-trnC-GCA N/A NC_016692.1
JF317353.1-trnC-GCA N/A JF317353.1
HQ325742.1-trnC-GCA N/A HQ325742.1

Sequence(s):
>NC_023215.1-trnC-GCA81
ggcgacatggccgagcggtaaggcgggggactgcaaatcccttattccccagttcaaatccgggtgtcgcctgatcaaca
a
back to top
>NC_016692.1-trnC-GCA81
ggcgacatggccgagcggtaaggcgggggactgcaaatcccttattccccagttcaaatccgggtgtcgcctgatcaaca
a
back to top
>JF317353.1-trnC-GCA81
ggcgacatggccgagcggtaaggcgggggactgcaaatcccttattccccagttcaaatccgggtgtcgcctgatcaaca
a
back to top
>HQ325742.1-trnC-GCA81
ggcgacatggccgagcggtaaggcgggggactgcaaatcccttattccccagttcaaatccgggtgtcgcctgatcaaca
a
back to top
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
trnC-GCANC_023215.1-trnC-GCAGossypium herbaceumgene
trnC-GCANC_016692.1-trnC-GCAGossypium herbaceumgene
trnC-GCAJF317353.1-trnC-GCAGossypium herbaceumgene
trnC-GCAHQ325742.1-trnC-GCAGossypium herbaceumgene


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
CottonGen Gene Database2017-09-06