rpoB, rpoB (gene) Gossypium herbaceum

Gene Overview
Name rpoB
Gene Symbol rpoB
Type gene
Organism Gossypium herbaceum
Synonym RNA polymerase beta subunit
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Name Genome Location NCBI Accession
NC_023215.1-rpoB N/A NC_023215.1
NC_016692.1-rpoB N/A NC_016692.1
JF317353.1-rpoB.m14 N/A JF317353.1
HQ325742.1-rpoB.m14 N/A HQ325742.1
NC_023215.1-rpoB.m14 N/A NC_023215.1
NC_016692.1-rpoB.m14 N/A NC_016692.1
JF317353.1-rpoB N/A JF317353.1
HQ325742.1-rpoB N/A HQ325742.1

Sequence(s):
>NC_023215.1-rpoB3213
atgctcggggatgaaaatggggaaatgtctacaatacctgggttgaatcagatacaatttgaaggattttgtgggttcat
ggatcggggcttaacagaagaactttataagtttccaaaaattgaagatacagagcaagaaattgaatttcaattatttg
tggaaacatatcaattggtggaaccgttgataaaagaaagggatgctgtatatgaatcactcacatattcttctgaatta
tatgtatccgcaggattaatttggaaaaccagtaaggatatgcaagaacaaacaatttttattggaaacattcctttaat
gaactccctcggaacttctatagtaaatggaatatacagaattgtgatcaatcaaatattgcaaagccccggtatctatt
atcgatcagaattggatcataacggaatttcggtctatactggtaccataatatcagattggggagggaggttagaatta
gagattgatagaaaagcaaggatatgggctcgtgtaagtaggaaacagaaaatatctattctagttctatcatcagctat
gggttcgaatctaagagaaattctagagaatgtttgctaccctgagattttcttgtctttcctgaccgataaggaaaaaa
aaaaaattgggtcaaaagaaaatgccattttggagttttatcaacaattttcttgtgtaggcggggatccggtattttct
gaatccttgtgtaaggaattacaaaagaaattctttcagcaaagatgtgaattaggaaggattggtcgacgaaatatgaa
ccagagattgaatcttaatatacctcagaacaatacatttttgttaccgcgagatatattggcagctgcggatcgtttga
ttggaatgaaatttggaatgggtacacttgacgatatgaatcatttgaaaaataagcgtattcgttctgtagcggatctc
ttacaagatcaattcggattggctctggttcgtttagaaaatgtagttagaggaactatatgcggagcaattaggcataa
attgataccgactcctcagaatttggtaacttcgactccattaacaaccacttatgaatcctttttcggattacacccat
tgtctcaagttttggatcgaacaaatccattgacacaaatagtgcatgggagaaaattgagttatttgggccccggagga
ttgaccgggcgaactgctaattttcggatacgagatatccatcctagtcactatggacgcatttgcccaattgacacgtc
tgaagggatcaatgttggacttatcggatccttagcaattcatgccaggattggtcattgggggtctctagaaagtccat
tttataaaatctttgagagatcaaaaaaagcacagatgctttatttatccccaagtcgagatgaatattatatggtagcg
gcaggaaattctttggccttgaatcagggtattcaggaagaacaggttgttccggctcgataccgccaagaattcctgac
tattgcatgggaacaagttcatcttcgaagtatttttccttttcaatatttttctattggagcttccctcattcctttta
tcgagcataatgacgcgaatcgggctttaatgagttctaatatgcaacgccaagcagttccgctttctcgttccgagaag
tgcattgttggaactgggttggaacgccaagtggctctagattcaggagttcccgctatagccgatcacgagggaaagat
catttcgaccgatactgacaagattattttatcgggcaatggagatgctctaggcattccattagttatgtatcaacgtt
ccaacaaaaatacttgtatgcatcaaactgcccgggttcggcggggtaaatgcattaaaaaggggcaaattttagcggac
ggtgccgctacggttggtggcgaactcgctttgggcaaaaacgtactagtagcttatatgccatgggaaggttacaattt
tgaggatgcggtactcattagcgagcgtctagtatatgaagatatttatacttcttttcacatacgcaaatatgaaattc
agactcatgtgacaagccaaggtcctgaaagaatcactaacgaaataccgcacctagaagcccatttactccgcaattta
gacaaaaatggaattgtgatgctgggatcttgggtggagacaggcgatattttagtagggaaattaacgcctcaggtggc
gaaagaatcatcgtatgctccagaagatagattattacgggccatacttgggattcaggtatccacttcaaaggaaactt
gtctcaaattacctataggtgggaggggtcgagtcatcgatgtgagatgggtccagaaaaaagggggttctagttataat
ccggaaacgattcgtgtatatatttcacagaaacgcgaaatcaaagtaggcgataaagtagccggaaggcatggaaataa
agggatcatttcaaaaattttacctagacaggatatgccttatttgcaagacggaagacctgttgatatggtcttcaacc
cattaggagtaccttcacgaatgaatgtaggacagctatttgaatgctcgcttgggttagcagggagtctactagataga
cattatcgaatagcaccatttgatgagagatatgaacaagaggcttcgagaaaactagtgttttccgaattatatcaagc
cagtaagcaaacagcgaatccatgggtatttgaacccgaatatccaggaaaaagcagaatatttgatggaagaacgggag
gcccctttgagcaacctgttataataggaaaaccttatatcttgaaattaattcatcaagttgatgataaaatacatggg
cgttccagtggacattatgcacttgttacacaacaaccacttagaggaaggtccaagcaaggaggacaacgggtaggaga
aatggaggtttgggctctagagggatttggtgttgctcatattttacaagaaatgcttacttataaatctgatcatatta
gagctcgccaagaagtacttgggactacgatcattggaggaacaatacctaaacccgaagatgctccagaatcttttcga
ttgctcgtccgagaattacgatctttggctctggaactgaatcatttccttgtatctgagaagaacttccagattaatag
gaaggaagcttaa
back to top
>NC_016692.1-rpoB3213
atgctcggggatgaaaatggggaaatgtctacaatacctgggttgaatcagatacaatttgaaggattttgtgggttcat
ggatcggggcttaacagaagaactttataagtttccaaaaattgaagatacagagcaagaaattgaatttcaattatttg
tggaaacatatcaattggtggaaccgttgataaaagaaagggatgctgtatatgaatcactcacatattcttctgaatta
tatgtatccgcaggattaatttggaaaaccagtaaggatatgcaagaacaaacaatttttattggaaacattcctttaat
gaactccctcggaacttctatagtaaatggaatatacagaattgtgatcaatcaaatattgcaaagccccggtatctatt
atcgatcagaattggatcataacggaatttcggtctatactggtaccataatatcagattggggagggaggttagaatta
gagattgatagaaaagcaaggatatgggctcgtgtaagtaggaaacagaaaatatctattctagttctatcatcagctat
gggttcgaatctaagagaaattctagagaatgtttgctaccctgagattttcttgtctttcctgaccgataaggaaaaaa
aaaaaattgggtcaaaagaaaatgccattttggagttttatcaacaattttcttgtgtaggcggggatccggtattttct
gaatccttgtgtaaggaattacaaaagaaattctttcagcaaagatgtgaattaggaaggattggtcgacgaaatatgaa
ccagagattgaatcttaatatacctcagaacaatacatttttgttaccgcgagatatattggcagctgcggatcgtttga
ttggaatgaaatttggaatgggtacacttgacgatatgaatcatttgaaaaataagcgtattcgttctgtagcggatctc
ttacaagatcaattcggattggctctggttcgtttagaaaatgtagttagaggaactatatgcggagcaattaggcataa
attgataccgactcctcagaatttggtaacttcgactccattaacaaccacttatgaatcctttttcggattacacccat
tgtctcaagttttggatcgaacaaatccattgacacaaatagtgcatgggagaaaattgagttatttgggccccggagga
ttgaccgggcgaactgctaattttcggatacgagatatccatcctagtcactatggacgcatttgcccaattgacacgtc
tgaagggatcaatgttggacttatcggatccttagcaattcatgccaggattggtcattgggggtctctagaaagtccat
tttataaaatctttgagagatcaaaaaaagcacagatgctttatttatccccaagtcgagatgaatattatatggtagcg
gcaggaaattctttggccttgaatcagggtattcaggaagaacaggttgttccggctcgataccgccaagaattcctgac
tattgcatgggaacaagttcatcttcgaagtatttttccttttcaatatttttctattggagcttccctcattcctttta
tcgagcataatgacgcgaatcgggctttaatgagttctaatatgcaacgccaagcagttccgctttctcgttccgagaag
tgcattgttggaactgggttggaacgccaagtggctctagattcaggagttcccgctatagccgatcacgagggaaagat
catttccaccgatactgacaagattattttatcgggcaatggagatgctctaggcattccattagttatgtatcaacgtt
ccaacaaaaatacttgtatgcatcaaactgcccgggttcggcggggtaaatgcattaaaaaggggcaaattttagcggac
ggtgccgctacggttggtggcgaactcgctttgggcaaaaacgtactagtagcttatatgccatgggaaggttacaattt
tgaggatgcggtactcattagcgagcgtctagtatatgaagatatttatacttcttttcacatacgaaaatatgaaattc
agactcatgtgacaagccaaggtcctgaaagaatcactaacgaaataccgcacctagaagcccatttactccgcaattta
gacaaaaatggaattgtgatgctgggatcttgggtggagacaggcgatattttagtaggtaaattaacgcctcaggtggc
gaaagaatcatcgtatgctccagaagatagattattacgggccatacttgggattcaggtatccacttcaaaggaaacct
gtctaaaattacctataggtgggaggggtcgagtcatcgatgtgagatgggtccagaaaaaagggggttctagttataat
ccggaaacgattcgtgtctatatttcacagaaacgcgaaatcaaagtaggcgataaagtagccggaaggcatggaaataa
agggatcatttcaaaaattttacctagacaggatatgccttatttgcaagacggaagacctgttgatatggtcttcaacc
cattaggagtaccttcacgaatgaatgtaggacagctatttgaatgctcgcttgggttagcagggagtctactagataga
cattatcgaatagcaccatttgatgagagatatgaacaagaggcttcgagaaaactagtgttttccgaattatatcaagc
cagtaagcaaacagcgaatccatgggtatttgaacccgaatatccaggaaaaagccgaatatttgatggaagaacgggag
gcccctttgagcaacctgttataataggaaaaccttatatcttgaaattaattcatcaagttgatgataaaatacatggg
cgttccagtggacattatgcacttgttacacaacaaccacttagaggaaggtccaagcaaggaggacaacgggtaggaga
aatggaggtttgggctctagagggatttggtgttgctcatattttacaagaaatgcttacttataaatctgatcatatta
gagctcgccaagaagtacttgggactacgatcattggaggaacaatacctaaacccgaagatgctccagaatcttttcga
ttgctcgtccgagaattacgatctttggctctggaactgaatcatttccttgtatctgagaagaacttccagattaatag
gaaggaagcttaa
back to top
>JF317353.1-rpoB.m143213
atgctcggggatgaaaatggggaaatgtctacaatacctgggttgaatcagatacaatttgaaggattttgtgggttcat
ggatcggggcttaacagaagaactttataagtttccaaaaattgaagatacagagcaagaaattgaatttcaattatttg
tggaaacatatcaattggtggaaccgttgataaaagaaagggatgctgtatatgaatcactcacatattcttctgaatta
tatgtatccgcaggattaatttggaaaaccagtaaggatatgcaagaacaaacaatttttattggaaacattcctttaat
gaactccctcggaacttctatagtaaatggaatatacagaattgtgatcaatcaaatattgcaaagccccggtatctatt
atcgatcagaattggatcataacggaatttcggtctatactggtaccataatatcagattggggagggaggttagaatta
gagattgatagaaaagcaaggatatgggctcgtgtaagtaggaaacagaaaatatctattctagttctatcatcagctat
gggttcgaatctaagagaaattctagagaatgtttgctaccctgagattttcttgtctttcctgaccgataaggaaaaaa
aaaaaattgggtcaaaagaaaatgccattttggagttttatcaacaattttcttgtgtaggcggggatccggtattttct
gaatccttgtgtaaggaattacaaaagaaattctttcagcaaagatgtgaattaggaaggattggtcgacgaaatatgaa
ccagagattgaatcttaatatacctcagaacaatacatttttgttaccgcgagatatattggcagctgcggatcgtttga
ttggaatgaaatttggaatgggtacacttgacgatatgaatcatttgaaaaataagcgtattcgttctgtagcggatctc
ttacaagatcaattcggattggctctggttcgtttagaaaatgtagttagaggaactatatgcggagcaattaggcataa
attgataccgactcctcagaatttggtaacttcgactccattaacaaccacttatgaatcctttttcggattacacccat
tgtctcaagttttggatcgaacaaatccattgacacaaatagtgcatgggagaaaattgagttatttgggccccggagga
ttgaccgggcgaactgctaattttcggatacgagatatccatcctagtcactatggacgcatttgcccaattgacacgtc
tgaagggatcaatgttggacttatcggatccttagcaattcatgccaggattggtcattgggggtctctagaaagtccat
tttataaaatctttgagagatcaaaaaaagcacagatgctttatttatccccaagtcgagatgaatattatatggtagcg
gcaggaaattctttggccttgaatcagggtattcaggaagaacaggttgttccggctcgataccgccaagaattcctgac
tattgcatgggaacaagttcatcttcgaagtatttttccttttcaatatttttctattggagcttccctcattcctttta
tcgagcataatgacgcgaatcgggctttaatgagttctaatatgcaacgccaagcagttccgctttctcgttccgagaag
tgcattgttggaactgggttggaacgccaagtggctctagattcaggagttcccgctatagccgatcacgagggaaagat
catttcgaccgatactgacaagattattttatcgggcaatggagatgctctaggcattccattagttatgtatcaacgtt
ccaacaaaaatacttgtatgcatcaaactgcccgggttcggcggggtaaatgcattaaaaaggggcaaattttagcggac
ggtgccgctacggttggtggcgaactcgctttgggcaaaaacgtactagtagcttatatgccatgggaaggttacaattt
tgaggatgcggtactcattagcgagcgtctagtatatgaagatatttatacttcttttcacatacgcaaatatgaaattc
agactcatgtgacaagccaaggtcctgaaagaatcactaacgaaataccgcacctagaagcccatttactccgcaattta
gacaaaaatggaattgtgatgctgggatcttgggtggagacaggcgatattttagtagggaaattaacgcctcaggtggc
gaaagaatcatcgtatgctccagaagatagattattacgggccatacttgggattcaggtatccacttcaaaggaaactt
gtctcaaattacctataggtgggaggggtcgagtcatcgatgtgagatgggtccagaaaaaagggggttctagttataat
ccggaaacgattcgtgtatatatttcacagaaacgcgaaatcaaagtaggcgataaagtagccggaaggcatggaaataa
agggatcatttcaaaaattttacctagacaggatatgccttatttgcaagacggaagacctgttgatatggtcttcaacc
cattaggagtaccttcacgaatgaatgtaggacagctatttgaatgctcgcttgggttagcagggagtctactagataga
cattatcgaatagcaccatttgatgagagatatgaacaagaggcttcgagaaaactagtgttttccgaattatatcaagc
cagtaagcaaacagcgaatccatgggtatttgaacccgaatatccaggaaaaagcagaatatttgatggaagaacgggag
gcccctttgagcaacctgttataataggaaaaccttatatcttgaaattaattcatcaagttgatgataaaatacatggg
cgttccagtggacattatgcacttgttacacaacaaccacttagaggaaggtccaagcaaggaggacaacgggtaggaga
aatggaggtttgggctctagagggatttggtgttgctcatattttacaagaaatgcttacttataaatctgatcatatta
gagctcgccaagaagtacttgggactacgatcattggaggaacaatacctaaacccgaagatgctccagaatcttttcga
ttgctcgtccgagaattacgatctttggctctggaactgaatcatttccttgtatctgagaagaacttccagattaatag
gaaggaagcttaa
back to top
>HQ325742.1-rpoB.m143213
atgctcggggatgaaaatggggaaatgtctacaatacctgggttgaatcagatacaatttgaaggattttgtgggttcat
ggatcggggcttaacagaagaactttataagtttccaaaaattgaagatacagagcaagaaattgaatttcaattatttg
tggaaacatatcaattggtggaaccgttgataaaagaaagggatgctgtatatgaatcactcacatattcttctgaatta
tatgtatccgcaggattaatttggaaaaccagtaaggatatgcaagaacaaacaatttttattggaaacattcctttaat
gaactccctcggaacttctatagtaaatggaatatacagaattgtgatcaatcaaatattgcaaagccccggtatctatt
atcgatcagaattggatcataacggaatttcggtctatactggtaccataatatcagattggggagggaggttagaatta
gagattgatagaaaagcaaggatatgggctcgtgtaagtaggaaacagaaaatatctattctagttctatcatcagctat
gggttcgaatctaagagaaattctagagaatgtttgctaccctgagattttcttgtctttcctgaccgataaggaaaaaa
aaaaaattgggtcaaaagaaaatgccattttggagttttatcaacaattttcttgtgtaggcggggatccggtattttct
gaatccttgtgtaaggaattacaaaagaaattctttcagcaaagatgtgaattaggaaggattggtcgacgaaatatgaa
ccagagattgaatcttaatatacctcagaacaatacatttttgttaccgcgagatatattggcagctgcggatcgtttga
ttggaatgaaatttggaatgggtacacttgacgatatgaatcatttgaaaaataagcgtattcgttctgtagcggatctc
ttacaagatcaattcggattggctctggttcgtttagaaaatgtagttagaggaactatatgcggagcaattaggcataa
attgataccgactcctcagaatttggtaacttcgactccattaacaaccacttatgaatcctttttcggattacacccat
tgtctcaagttttggatcgaacaaatccattgacacaaatagtgcatgggagaaaattgagttatttgggccccggagga
ttgaccgggcgaactgctaattttcggatacgagatatccatcctagtcactatggacgcatttgcccaattgacacgtc
tgaagggatcaatgttggacttatcggatccttagcaattcatgccaggattggtcattgggggtctctagaaagtccat
tttataaaatctttgagagatcaaaaaaagcacagatgctttatttatccccaagtcgagatgaatattatatggtagcg
gcaggaaattctttggccttgaatcagggtattcaggaagaacaggttgttccggctcgataccgccaagaattcctgac
tattgcatgggaacaagttcatcttcgaagtatttttccttttcaatatttttctattggagcttccctcattcctttta
tcgagcataatgacgcgaatcgggctttaatgagttctaatatgcaacgccaagcagttccgctttctcgttccgagaag
tgcattgttggaactgggttggaacgccaagtggctctagattcaggagttcccgctatagccgatcacgagggaaagat
catttccaccgatactgacaagattattttatcgggcaatggagatgctctaggcattccattagttatgtatcaacgtt
ccaacaaaaatacttgtatgcatcaaactgcccgggttcggcggggtaaatgcattaaaaaggggcaaattttagcggac
ggtgccgctacggttggtggcgaactcgctttgggcaaaaacgtactagtagcttatatgccatgggaaggttacaattt
tgaggatgcggtactcattagcgagcgtctagtatatgaagatatttatacttcttttcacatacgaaaatatgaaattc
agactcatgtgacaagccaaggtcctgaaagaatcactaacgaaataccgcacctagaagcccatttactccgcaattta
gacaaaaatggaattgtgatgctgggatcttgggtggagacaggcgatattttagtaggtaaattaacgcctcaggtggc
gaaagaatcatcgtatgctccagaagatagattattacgggccatacttgggattcaggtatccacttcaaaggaaacct
gtctaaaattacctataggtgggaggggtcgagtcatcgatgtgagatgggtccagaaaaaagggggttctagttataat
ccggaaacgattcgtgtctatatttcacagaaacgcgaaatcaaagtaggcgataaagtagccggaaggcatggaaataa
agggatcatttcaaaaattttacctagacaggatatgccttatttgcaagacggaagacctgttgatatggtcttcaacc
cattaggagtaccttcacgaatgaatgtaggacagctatttgaatgctcgcttgggttagcagggagtctactagataga
cattatcgaatagcaccatttgatgagagatatgaacaagaggcttcgagaaaactagtgttttccgaattatatcaagc
cagtaagcaaacagcgaatccatgggtatttgaacccgaatatccaggaaaaagccgaatatttgatggaagaacgggag
gcccctttgagcaacctgttataataggaaaaccttatatcttgaaattaattcatcaagttgatgataaaatacatggg
cgttccagtggacattatgcacttgttacacaacaaccacttagaggaaggtccaagcaaggaggacaacgggtaggaga
aatggaggtttgggctctagagggatttggtgttgctcatattttacaagaaatgcttacttataaatctgatcatatta
gagctcgccaagaagtacttgggactacgatcattggaggaacaatacctaaacccgaagatgctccagaatcttttcga
ttgctcgtccgagaattacgatctttggctctggaactgaatcatttccttgtatctgagaagaacttccagattaatag
gaaggaagcttaa
back to top
>NC_023215.1-rpoB.m143213
atgctcggggatgaaaatggggaaatgtctacaatacctgggttgaatcagatacaatttgaaggattttgtgggttcat
ggatcggggcttaacagaagaactttataagtttccaaaaattgaagatacagagcaagaaattgaatttcaattatttg
tggaaacatatcaattggtggaaccgttgataaaagaaagggatgctgtatatgaatcactcacatattcttctgaatta
tatgtatccgcaggattaatttggaaaaccagtaaggatatgcaagaacaaacaatttttattggaaacattcctttaat
gaactccctcggaacttctatagtaaatggaatatacagaattgtgatcaatcaaatattgcaaagccccggtatctatt
atcgatcagaattggatcataacggaatttcggtctatactggtaccataatatcagattggggagggaggttagaatta
gagattgatagaaaagcaaggatatgggctcgtgtaagtaggaaacagaaaatatctattctagttctatcatcagctat
gggttcgaatctaagagaaattctagagaatgtttgctaccctgagattttcttgtctttcctgaccgataaggaaaaaa
aaaaaattgggtcaaaagaaaatgccattttggagttttatcaacaattttcttgtgtaggcggggatccggtattttct
gaatccttgtgtaaggaattacaaaagaaattctttcagcaaagatgtgaattaggaaggattggtcgacgaaatatgaa
ccagagattgaatcttaatatacctcagaacaatacatttttgttaccgcgagatatattggcagctgcggatcgtttga
ttggaatgaaatttggaatgggtacacttgacgatatgaatcatttgaaaaataagcgtattcgttctgtagcggatctc
ttacaagatcaattcggattggctctggttcgtttagaaaatgtagttagaggaactatatgcggagcaattaggcataa
attgataccgactcctcagaatttggtaacttcgactccattaacaaccacttatgaatcctttttcggattacacccat
tgtctcaagttttggatcgaacaaatccattgacacaaatagtgcatgggagaaaattgagttatttgggccccggagga
ttgaccgggcgaactgctaattttcggatacgagatatccatcctagtcactatggacgcatttgcccaattgacacgtc
tgaagggatcaatgttggacttatcggatccttagcaattcatgccaggattggtcattgggggtctctagaaagtccat
tttataaaatctttgagagatcaaaaaaagcacagatgctttatttatccccaagtcgagatgaatattatatggtagcg
gcaggaaattctttggccttgaatcagggtattcaggaagaacaggttgttccggctcgataccgccaagaattcctgac
tattgcatgggaacaagttcatcttcgaagtatttttccttttcaatatttttctattggagcttccctcattcctttta
tcgagcataatgacgcgaatcgggctttaatgagttctaatatgcaacgccaagcagttccgctttctcgttccgagaag
tgcattgttggaactgggttggaacgccaagtggctctagattcaggagttcccgctatagccgatcacgagggaaagat
catttcgaccgatactgacaagattattttatcgggcaatggagatgctctaggcattccattagttatgtatcaacgtt
ccaacaaaaatacttgtatgcatcaaactgcccgggttcggcggggtaaatgcattaaaaaggggcaaattttagcggac
ggtgccgctacggttggtggcgaactcgctttgggcaaaaacgtactagtagcttatatgccatgggaaggttacaattt
tgaggatgcggtactcattagcgagcgtctagtatatgaagatatttatacttcttttcacatacgcaaatatgaaattc
agactcatgtgacaagccaaggtcctgaaagaatcactaacgaaataccgcacctagaagcccatttactccgcaattta
gacaaaaatggaattgtgatgctgggatcttgggtggagacaggcgatattttagtagggaaattaacgcctcaggtggc
gaaagaatcatcgtatgctccagaagatagattattacgggccatacttgggattcaggtatccacttcaaaggaaactt
gtctcaaattacctataggtgggaggggtcgagtcatcgatgtgagatgggtccagaaaaaagggggttctagttataat
ccggaaacgattcgtgtatatatttcacagaaacgcgaaatcaaagtaggcgataaagtagccggaaggcatggaaataa
agggatcatttcaaaaattttacctagacaggatatgccttatttgcaagacggaagacctgttgatatggtcttcaacc
cattaggagtaccttcacgaatgaatgtaggacagctatttgaatgctcgcttgggttagcagggagtctactagataga
cattatcgaatagcaccatttgatgagagatatgaacaagaggcttcgagaaaactagtgttttccgaattatatcaagc
cagtaagcaaacagcgaatccatgggtatttgaacccgaatatccaggaaaaagcagaatatttgatggaagaacgggag
gcccctttgagcaacctgttataataggaaaaccttatatcttgaaattaattcatcaagttgatgataaaatacatggg
cgttccagtggacattatgcacttgttacacaacaaccacttagaggaaggtccaagcaaggaggacaacgggtaggaga
aatggaggtttgggctctagagggatttggtgttgctcatattttacaagaaatgcttacttataaatctgatcatatta
gagctcgccaagaagtacttgggactacgatcattggaggaacaatacctaaacccgaagatgctccagaatcttttcga
ttgctcgtccgagaattacgatctttggctctggaactgaatcatttccttgtatctgagaagaacttccagattaatag
gaaggaagcttaa
back to top
>NC_016692.1-rpoB.m143213
atgctcggggatgaaaatggggaaatgtctacaatacctgggttgaatcagatacaatttgaaggattttgtgggttcat
ggatcggggcttaacagaagaactttataagtttccaaaaattgaagatacagagcaagaaattgaatttcaattatttg
tggaaacatatcaattggtggaaccgttgataaaagaaagggatgctgtatatgaatcactcacatattcttctgaatta
tatgtatccgcaggattaatttggaaaaccagtaaggatatgcaagaacaaacaatttttattggaaacattcctttaat
gaactccctcggaacttctatagtaaatggaatatacagaattgtgatcaatcaaatattgcaaagccccggtatctatt
atcgatcagaattggatcataacggaatttcggtctatactggtaccataatatcagattggggagggaggttagaatta
gagattgatagaaaagcaaggatatgggctcgtgtaagtaggaaacagaaaatatctattctagttctatcatcagctat
gggttcgaatctaagagaaattctagagaatgtttgctaccctgagattttcttgtctttcctgaccgataaggaaaaaa
aaaaaattgggtcaaaagaaaatgccattttggagttttatcaacaattttcttgtgtaggcggggatccggtattttct
gaatccttgtgtaaggaattacaaaagaaattctttcagcaaagatgtgaattaggaaggattggtcgacgaaatatgaa
ccagagattgaatcttaatatacctcagaacaatacatttttgttaccgcgagatatattggcagctgcggatcgtttga
ttggaatgaaatttggaatgggtacacttgacgatatgaatcatttgaaaaataagcgtattcgttctgtagcggatctc
ttacaagatcaattcggattggctctggttcgtttagaaaatgtagttagaggaactatatgcggagcaattaggcataa
attgataccgactcctcagaatttggtaacttcgactccattaacaaccacttatgaatcctttttcggattacacccat
tgtctcaagttttggatcgaacaaatccattgacacaaatagtgcatgggagaaaattgagttatttgggccccggagga
ttgaccgggcgaactgctaattttcggatacgagatatccatcctagtcactatggacgcatttgcccaattgacacgtc
tgaagggatcaatgttggacttatcggatccttagcaattcatgccaggattggtcattgggggtctctagaaagtccat
tttataaaatctttgagagatcaaaaaaagcacagatgctttatttatccccaagtcgagatgaatattatatggtagcg
gcaggaaattctttggccttgaatcagggtattcaggaagaacaggttgttccggctcgataccgccaagaattcctgac
tattgcatgggaacaagttcatcttcgaagtatttttccttttcaatatttttctattggagcttccctcattcctttta
tcgagcataatgacgcgaatcgggctttaatgagttctaatatgcaacgccaagcagttccgctttctcgttccgagaag
tgcattgttggaactgggttggaacgccaagtggctctagattcaggagttcccgctatagccgatcacgagggaaagat
catttccaccgatactgacaagattattttatcgggcaatggagatgctctaggcattccattagttatgtatcaacgtt
ccaacaaaaatacttgtatgcatcaaactgcccgggttcggcggggtaaatgcattaaaaaggggcaaattttagcggac
ggtgccgctacggttggtggcgaactcgctttgggcaaaaacgtactagtagcttatatgccatgggaaggttacaattt
tgaggatgcggtactcattagcgagcgtctagtatatgaagatatttatacttcttttcacatacgaaaatatgaaattc
agactcatgtgacaagccaaggtcctgaaagaatcactaacgaaataccgcacctagaagcccatttactccgcaattta
gacaaaaatggaattgtgatgctgggatcttgggtggagacaggcgatattttagtaggtaaattaacgcctcaggtggc
gaaagaatcatcgtatgctccagaagatagattattacgggccatacttgggattcaggtatccacttcaaaggaaacct
gtctaaaattacctataggtgggaggggtcgagtcatcgatgtgagatgggtccagaaaaaagggggttctagttataat
ccggaaacgattcgtgtctatatttcacagaaacgcgaaatcaaagtaggcgataaagtagccggaaggcatggaaataa
agggatcatttcaaaaattttacctagacaggatatgccttatttgcaagacggaagacctgttgatatggtcttcaacc
cattaggagtaccttcacgaatgaatgtaggacagctatttgaatgctcgcttgggttagcagggagtctactagataga
cattatcgaatagcaccatttgatgagagatatgaacaagaggcttcgagaaaactagtgttttccgaattatatcaagc
cagtaagcaaacagcgaatccatgggtatttgaacccgaatatccaggaaaaagccgaatatttgatggaagaacgggag
gcccctttgagcaacctgttataataggaaaaccttatatcttgaaattaattcatcaagttgatgataaaatacatggg
cgttccagtggacattatgcacttgttacacaacaaccacttagaggaaggtccaagcaaggaggacaacgggtaggaga
aatggaggtttgggctctagagggatttggtgttgctcatattttacaagaaatgcttacttataaatctgatcatatta
gagctcgccaagaagtacttgggactacgatcattggaggaacaatacctaaacccgaagatgctccagaatcttttcga
ttgctcgtccgagaattacgatctttggctctggaactgaatcatttccttgtatctgagaagaacttccagattaatag
gaaggaagcttaa
back to top
>JF317353.1-rpoB3213
atgctcggggatgaaaatggggaaatgtctacaatacctgggttgaatcagatacaatttgaaggattttgtgggttcat
ggatcggggcttaacagaagaactttataagtttccaaaaattgaagatacagagcaagaaattgaatttcaattatttg
tggaaacatatcaattggtggaaccgttgataaaagaaagggatgctgtatatgaatcactcacatattcttctgaatta
tatgtatccgcaggattaatttggaaaaccagtaaggatatgcaagaacaaacaatttttattggaaacattcctttaat
gaactccctcggaacttctatagtaaatggaatatacagaattgtgatcaatcaaatattgcaaagccccggtatctatt
atcgatcagaattggatcataacggaatttcggtctatactggtaccataatatcagattggggagggaggttagaatta
gagattgatagaaaagcaaggatatgggctcgtgtaagtaggaaacagaaaatatctattctagttctatcatcagctat
gggttcgaatctaagagaaattctagagaatgtttgctaccctgagattttcttgtctttcctgaccgataaggaaaaaa
aaaaaattgggtcaaaagaaaatgccattttggagttttatcaacaattttcttgtgtaggcggggatccggtattttct
gaatccttgtgtaaggaattacaaaagaaattctttcagcaaagatgtgaattaggaaggattggtcgacgaaatatgaa
ccagagattgaatcttaatatacctcagaacaatacatttttgttaccgcgagatatattggcagctgcggatcgtttga
ttggaatgaaatttggaatgggtacacttgacgatatgaatcatttgaaaaataagcgtattcgttctgtagcggatctc
ttacaagatcaattcggattggctctggttcgtttagaaaatgtagttagaggaactatatgcggagcaattaggcataa
attgataccgactcctcagaatttggtaacttcgactccattaacaaccacttatgaatcctttttcggattacacccat
tgtctcaagttttggatcgaacaaatccattgacacaaatagtgcatgggagaaaattgagttatttgggccccggagga
ttgaccgggcgaactgctaattttcggatacgagatatccatcctagtcactatggacgcatttgcccaattgacacgtc
tgaagggatcaatgttggacttatcggatccttagcaattcatgccaggattggtcattgggggtctctagaaagtccat
tttataaaatctttgagagatcaaaaaaagcacagatgctttatttatccccaagtcgagatgaatattatatggtagcg
gcaggaaattctttggccttgaatcagggtattcaggaagaacaggttgttccggctcgataccgccaagaattcctgac
tattgcatgggaacaagttcatcttcgaagtatttttccttttcaatatttttctattggagcttccctcattcctttta
tcgagcataatgacgcgaatcgggctttaatgagttctaatatgcaacgccaagcagttccgctttctcgttccgagaag
tgcattgttggaactgggttggaacgccaagtggctctagattcaggagttcccgctatagccgatcacgagggaaagat
catttcgaccgatactgacaagattattttatcgggcaatggagatgctctaggcattccattagttatgtatcaacgtt
ccaacaaaaatacttgtatgcatcaaactgcccgggttcggcggggtaaatgcattaaaaaggggcaaattttagcggac
ggtgccgctacggttggtggcgaactcgctttgggcaaaaacgtactagtagcttatatgccatgggaaggttacaattt
tgaggatgcggtactcattagcgagcgtctagtatatgaagatatttatacttcttttcacatacgcaaatatgaaattc
agactcatgtgacaagccaaggtcctgaaagaatcactaacgaaataccgcacctagaagcccatttactccgcaattta
gacaaaaatggaattgtgatgctgggatcttgggtggagacaggcgatattttagtagggaaattaacgcctcaggtggc
gaaagaatcatcgtatgctccagaagatagattattacgggccatacttgggattcaggtatccacttcaaaggaaactt
gtctcaaattacctataggtgggaggggtcgagtcatcgatgtgagatgggtccagaaaaaagggggttctagttataat
ccggaaacgattcgtgtatatatttcacagaaacgcgaaatcaaagtaggcgataaagtagccggaaggcatggaaataa
agggatcatttcaaaaattttacctagacaggatatgccttatttgcaagacggaagacctgttgatatggtcttcaacc
cattaggagtaccttcacgaatgaatgtaggacagctatttgaatgctcgcttgggttagcagggagtctactagataga
cattatcgaatagcaccatttgatgagagatatgaacaagaggcttcgagaaaactagtgttttccgaattatatcaagc
cagtaagcaaacagcgaatccatgggtatttgaacccgaatatccaggaaaaagcagaatatttgatggaagaacgggag
gcccctttgagcaacctgttataataggaaaaccttatatcttgaaattaattcatcaagttgatgataaaatacatggg
cgttccagtggacattatgcacttgttacacaacaaccacttagaggaaggtccaagcaaggaggacaacgggtaggaga
aatggaggtttgggctctagagggatttggtgttgctcatattttacaagaaatgcttacttataaatctgatcatatta
gagctcgccaagaagtacttgggactacgatcattggaggaacaatacctaaacccgaagatgctccagaatcttttcga
ttgctcgtccgagaattacgatctttggctctggaactgaatcatttccttgtatctgagaagaacttccagattaatag
gaaggaagcttaa
back to top
>HQ325742.1-rpoB3213
atgctcggggatgaaaatggggaaatgtctacaatacctgggttgaatcagatacaatttgaaggattttgtgggttcat
ggatcggggcttaacagaagaactttataagtttccaaaaattgaagatacagagcaagaaattgaatttcaattatttg
tggaaacatatcaattggtggaaccgttgataaaagaaagggatgctgtatatgaatcactcacatattcttctgaatta
tatgtatccgcaggattaatttggaaaaccagtaaggatatgcaagaacaaacaatttttattggaaacattcctttaat
gaactccctcggaacttctatagtaaatggaatatacagaattgtgatcaatcaaatattgcaaagccccggtatctatt
atcgatcagaattggatcataacggaatttcggtctatactggtaccataatatcagattggggagggaggttagaatta
gagattgatagaaaagcaaggatatgggctcgtgtaagtaggaaacagaaaatatctattctagttctatcatcagctat
gggttcgaatctaagagaaattctagagaatgtttgctaccctgagattttcttgtctttcctgaccgataaggaaaaaa
aaaaaattgggtcaaaagaaaatgccattttggagttttatcaacaattttcttgtgtaggcggggatccggtattttct
gaatccttgtgtaaggaattacaaaagaaattctttcagcaaagatgtgaattaggaaggattggtcgacgaaatatgaa
ccagagattgaatcttaatatacctcagaacaatacatttttgttaccgcgagatatattggcagctgcggatcgtttga
ttggaatgaaatttggaatgggtacacttgacgatatgaatcatttgaaaaataagcgtattcgttctgtagcggatctc
ttacaagatcaattcggattggctctggttcgtttagaaaatgtagttagaggaactatatgcggagcaattaggcataa
attgataccgactcctcagaatttggtaacttcgactccattaacaaccacttatgaatcctttttcggattacacccat
tgtctcaagttttggatcgaacaaatccattgacacaaatagtgcatgggagaaaattgagttatttgggccccggagga
ttgaccgggcgaactgctaattttcggatacgagatatccatcctagtcactatggacgcatttgcccaattgacacgtc
tgaagggatcaatgttggacttatcggatccttagcaattcatgccaggattggtcattgggggtctctagaaagtccat
tttataaaatctttgagagatcaaaaaaagcacagatgctttatttatccccaagtcgagatgaatattatatggtagcg
gcaggaaattctttggccttgaatcagggtattcaggaagaacaggttgttccggctcgataccgccaagaattcctgac
tattgcatgggaacaagttcatcttcgaagtatttttccttttcaatatttttctattggagcttccctcattcctttta
tcgagcataatgacgcgaatcgggctttaatgagttctaatatgcaacgccaagcagttccgctttctcgttccgagaag
tgcattgttggaactgggttggaacgccaagtggctctagattcaggagttcccgctatagccgatcacgagggaaagat
catttccaccgatactgacaagattattttatcgggcaatggagatgctctaggcattccattagttatgtatcaacgtt
ccaacaaaaatacttgtatgcatcaaactgcccgggttcggcggggtaaatgcattaaaaaggggcaaattttagcggac
ggtgccgctacggttggtggcgaactcgctttgggcaaaaacgtactagtagcttatatgccatgggaaggttacaattt
tgaggatgcggtactcattagcgagcgtctagtatatgaagatatttatacttcttttcacatacgaaaatatgaaattc
agactcatgtgacaagccaaggtcctgaaagaatcactaacgaaataccgcacctagaagcccatttactccgcaattta
gacaaaaatggaattgtgatgctgggatcttgggtggagacaggcgatattttagtaggtaaattaacgcctcaggtggc
gaaagaatcatcgtatgctccagaagatagattattacgggccatacttgggattcaggtatccacttcaaaggaaacct
gtctaaaattacctataggtgggaggggtcgagtcatcgatgtgagatgggtccagaaaaaagggggttctagttataat
ccggaaacgattcgtgtctatatttcacagaaacgcgaaatcaaagtaggcgataaagtagccggaaggcatggaaataa
agggatcatttcaaaaattttacctagacaggatatgccttatttgcaagacggaagacctgttgatatggtcttcaacc
cattaggagtaccttcacgaatgaatgtaggacagctatttgaatgctcgcttgggttagcagggagtctactagataga
cattatcgaatagcaccatttgatgagagatatgaacaagaggcttcgagaaaactagtgttttccgaattatatcaagc
cagtaagcaaacagcgaatccatgggtatttgaacccgaatatccaggaaaaagccgaatatttgatggaagaacgggag
gcccctttgagcaacctgttataataggaaaaccttatatcttgaaattaattcatcaagttgatgataaaatacatggg
cgttccagtggacattatgcacttgttacacaacaaccacttagaggaaggtccaagcaaggaggacaacgggtaggaga
aatggaggtttgggctctagagggatttggtgttgctcatattttacaagaaatgcttacttataaatctgatcatatta
gagctcgccaagaagtacttgggactacgatcattggaggaacaatacctaaacccgaagatgctccagaatcttttcga
ttgctcgtccgagaattacgatctttggctctggaactgaatcatttccttgtatctgagaagaacttccagattaatag
gaaggaagcttaa
back to top
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
rpoBNC_023215.1-rpoBGossypium herbaceumgene
rpoBNC_016692.1-rpoBGossypium herbaceumgene
rpoBJF317353.1-rpoBGossypium herbaceumgene
rpoBHQ325742.1-rpoBGossypium herbaceumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
rpoBJF317353.1-rpoB.m14Gossypium herbaceummRNA
rpoBHQ325742.1-rpoB.m14Gossypium herbaceummRNA
rpoBNC_023215.1-rpoB.m14Gossypium herbaceummRNA
rpoBNC_016692.1-rpoB.m14Gossypium herbaceummRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
CottonGen Gene Database2017-09-06