rpoC1, rpoC1 (gene) Gossypium herbaceum

Gene Overview
Name rpoC1
Gene Symbol rpoC1
Type gene
Organism Gossypium herbaceum
Synonym RNA polymerase beta
RNA polymerase beta' subunit
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Name Genome Location NCBI Accession
NC_023215.1-rpoC1 N/A NC_023215.1
NC_016692.1-rpoC1 N/A NC_016692.1
JF317353.1-rpoC1.m13 N/A JF317353.1
HQ325742.1-rpoC1.m13 N/A HQ325742.1
NC_023215.1-rpoC1.m13 N/A NC_023215.1
NC_016692.1-rpoC1.m13 N/A NC_016692.1
JF317353.1-rpoC1 N/A JF317353.1
HQ325742.1-rpoC1 N/A HQ325742.1

Sequence(s):
>NC_023215.1-rpoC12819
atgatcgaccgatataaacatcaacaactccgaattggatcagtttctccccaacaaataagtgcttgggccaagaaaat
cctacctaatggagaaaccgttggagaggtgacaaaaccctatacttttcattacaaaaccaataaaccggaaaaggatg
gattattttgtgaaagaatttttggacctataaaaagtggaatttgcgcttgtggaaattatcgagtaattggaaatcaa
aaggagggccctaaattttgtgaacaatgcggagttgaatttgttgattctcggatacgaagatatcaaatgggatacat
aaggctggcatgtccagtaactcatgtatggtatttgaaacgccttcctagttatatcgccaatcttttagacaaacctc
ttaaagaattagagggtctagtatactgcgatgtgtgatttgatcgaaattattattttacagattaggaatgagaaact
gtcatcccattcaatcgaattgggatgccctggatctgacatgtctcttgggaagagtaacatgaagctcagaattatgg
gcgtattcaatactcccaaataaaaagggaattggtctatggtcgagtcagtaaaaataaataactaggaattttgagtt
gtacctcgtgaaaaaaagacttcttttttttgtggaattaaccgttctcatttcttttagttcttttagaaagaaatgaa
attatgttcaaggaaacaaatatgtcatggttgcaggagtctatacatcgcatataggcttaggctttaagttaagggca
tcgtggtataatcgtcgaggtaccgcaggacctaagagatcgaatggaagggtacatagacaagtaaatcccttatgaca
ctcctttaattttagaggattcagcattcgaggggaagtagactactcaagaatttcacatttcatttatgtcctaattt
tgaattgaataaagaattaagaaaatctaaatcaataaatcaataaaagaagaatcaatcaatgaaatgtttcttggaac
ttgagtaaagagtagaccttttttgggggttctagaatttgaaagcgagaactcctttactttatctttatttggtgtaa
ctacttgagccggatgagaggaaactctcatgtccgattttgagggggggatcccgcagggccctatcctaatttttctt
ttgctaggcccatcgctaaaaaacctactttcttacgattacgaggttcattcgaatatgaaattcaatcctggaaatac
agtatcccacttttttttactacccaaggtttcgatacatttcgaagtcgcgaaatttctaccggagcaggtgctattcg
agaacaattagccgatctagatttgcgaattcttatcgattattcggtggtagaatggaaagaattaggagaagaaggcc
tcacgggtaatgaatgggaagatcgaaaaattggaagaagaaaggattttttggttagacgcatggaattggctaagcat
tttattcgaacaaatatagaaccagaatggatggttttatgtctattaccggttcttcctcccgagttgagaccgatcat
tcagatagatgggggtaaactaatgagttcggatattaatgaactctatagaagagttatctatcgaaataatactctta
ccgatctattaacaacaagtagatctacgccaggggaattagtaatgtgtcaggaaaaattagtacaagaagccgtggat
acacttcttgataatggaatccgcggacaaccaatgagggacggtcataataaggtttacaagtcgttttcagatgtaat
tgaaggcaaagagggaagatttcgcgagactttgcttggcaaacgagtcgattattcgggacgttctgtcattgttgttg
gcccctcactttcattacatcgctgtggattgcctcgcgaaatagcaatagagcttttccagacatttgtaattcgcggt
ctaattagacaacatcttgctccgaacataggagttgctaagagtaaaattcgggaaaaagggccgattgtatgggaaat
actgcaagaagttatgcggggacatcctgtattgctgaatagagcgcctactctgcatagattaggtatacaggcattcc
aacctattttagtggaaggacgcgctatttgtttacatccattagtttgtaagggattcaatgcagactttgatggggat
caaatggcagttcatgtacctttatctttagaggcgcaagcggaggctcgtttacttatgttttctcatatgaatctctt
gtctccagctattggggatcccatttccgtaccgactcaagatatgcttattgggctctatgtattaacgagtgggaatc
gtcgaggtatttgtgcgaataggtataatccatggaatcgaaaaagctatcaaaatgaaagaattgacgataataactat
aagtctacaagggagccttttttttgtaattcctatgatgcgattggagcttataggcagaaaagaatcaatttagatag
tcctttgtggctccggtggcgactagagcaatgcgttattgcttcaagagaagctcccatcgaagttcactatgaatctt
tgggtacctatcatgagatttatggacattatctaatagtaagaagtttaaaaaaaaaaattctttgtatatacattcga
accactgttggtcatatttctctttaccgagaaatcgaagaagctatacaagggttttttcgggcctactcatatgatac
ccaatcatatggtatctaa
back to top
>NC_016692.1-rpoC12811
atgatcgaccgatataaacatcaacaactccgaattggatcagtttctccccaacaaataagtgcttgggccaagaaaat
cctacctaatggagaaaccgttggagaggtgacaaaaccctatacttttcattacaaaaccaataaaccggaaaaggatg
gattattttgtgaaagaatttttggacctataaaaagtggaatttgcgcttgtggaaattatcgagtaattggaaatcaa
aaggagggccctaaattttgtgaacaatgcggagttgaatttgttgattctcggatacgaagatatcaaatgggatacat
aaggctggcatgtccagtaactcatgtatggtatttgaaacgtcttcctagttatatcgccaatcttttagacaaacctc
ttaaagaattagagggtctagtatactgcgatgtgtgatttgatcgaaattattattttacagattaggaatgagaaact
gtcatcccattcaatcgaattgggatgccctggatctgacatgtctcttgggaagagtaacatgaagctcagaattatgg
gcgtattcaatactcccaaataaaaagggaattggtctatggtcgagtcagtaaaaataaataactaggaattttgagtt
gtacctcgtgaaaaaaagacttctttttttgtggaattaaccgttctcatttcttttagttcttttagaaagaaatgaaa
ttatgttcaaggaaacaaatatgtcatggttgcaggagtctatacatcgcatataggcttaggctttaagttaagggcat
cgtggtataatcgtcgaggtaccgcaggacctaagagatcgaatggaagggtacatagacaagtaaatcccttatgacac
tcctttaatttaagaggattcagcattcgaggggaagtagactactcaagaatttcacatttcatttatgtcctaatttt
gaattgaataaagaattaagaaaatctaaatcaataaaagaagaatcaatcaatgaaatgtttcttggaacttgagtaaa
gagtagacctttttgggggggttctagaatttgaaagcgagaactcctttactttatctttatttggtgtaactacttga
gccggatgagaggaaactctcatgtccgattttgagggggggatcccgcagggccctatcctaatttttcttttgctagg
cccatcgctaaaaaacctactttcttacgattacgaggttcattcgaatatgaaattcaatcctggaaatacagtatccc
acttttttttactacccaaggtttcgatacatttcgaagtcgcgaaatttctaccggagcaggtgctattcgagaacaat
tagccgatctagatttgcgaattcttatcgattattcggtggtagaatggaaagaattaggagaagaaggcctcacgggt
aatgaatgggaagatcgaaaaattggaagaagaaaggattttttggttagacgcatggaattggctaagcattttattcg
aacaaatatagaaccagaatggatggttttatgtctattaccggttcttcctcccgagttgagaccgatcattcagatag
atgggggtaaactaatgagttcggatattaatgaactctatagaagagttatctatcgaaataatactcttaccgatcta
ttaacaacaagtagatctacgccaggggaattagtaatgtgtcaggaaaaattggtacaagaagccgtggatacacttct
tgataatggaatccgcggacaaccaatgagggacggtcataataaggtttacaagtcgttttcagatgtaattgaaggca
aagagggaagatttcgcgagactttgcttggcaaacgagtcgattattcgggacgttctgtcattgttgttggcccctca
ctttcattacatcgctgtggattgcctcgcgaaatagcaatagagcttttccagacatttgtaattcgcggtctaattag
acaacatcttgctccgaacataggagttgctaagagtaaaattcgggaaaaagggccgattgtatgggaaatactgcaag
aagttatgcggggacatcctgtattgctgaatagagcgcctactctgcatagattaggtatacaggcattccaacctatt
ttagtggaaggacgcgctatttgtttacatccattagtttgtaagggattcaatgcagactttgatggggatcaaatggc
agttcatgtacctttatctttagaggcgcaagcggaggctcgtttacttatgttttctcatatgaatctcttgtctccag
ctattggggatcccatttccgtacctactcaagatatgcttattgggctctatgtattaacgagtgggaatcgtcgaggt
atttgtgcgaataggtataatccatggaatcgaaaaagctatcaaaatgaaagaattgacgataataactataagtctac
aagggagccttttttttgtaattcctatgatgcgattggagcttataggcagaaaagaatcaatttagatagtcctttgt
ggctccggtggcgactagagcaatgcgttattgcttcaagagaagctcccatcgaagttcactatgaatcttcgggtacc
tatcatgagatttatggacattatctaatagtaagaagtttaaaaaaaaaaattctttgtatatacattcgaaccactgt
tggtcatatttctctttaccgagaaatcgaagaagctatacaagggttttttcgggcctactcatatgatacccaatcat
atggtatctaa
back to top
>JF317353.1-rpoC1.m132070
atgatcgaccgatataaacatcaacaactccgaattggatcagtttctccccaacaaataagtgcttgggccaagaaaat
cctacctaatggagaaaccgttggagaggtgacaaaaccctatacttttcattacaaaaccaataaaccggaaaaggatg
gattattttgtgaaagaatttttggacctataaaaagtggaatttgcgcttgtggaaattatcgagtaattggaaatcaa
aaggagggccctaaattttgtgaacaatgcggagttgaatttgttgattctcggatacgaagatatcaaatgggatacat
aaggctggcatgtccagtaactcatgtatggtatttgaaacgccttcctagttatatcgccaatcttttagacaaacctc
ttaaagaattagagggtctagtatactgcgatgtgtatcctaatttttcttttgctaggcccatcgctaaaaaacctact
ttcttacgattacgaggttcattcgaatatgaaattcaatcctggaaatacagtatcccacttttttttactacccaagg
tttcgatacatttcgaagtcgcgaaatttctaccggagcaggtgctattcgagaacaattagccgatctagatttgcgaa
ttcttatcgattattcggtggtagaatggaaagaattaggagaagaaggcctcacgggtaatgaatgggaagatcgaaaa
attggaagaagaaaggattttttggttagacgcatggaattggctaagcattttattcgaacaaatatagaaccagaatg
gatggttttatgtctattaccggttcttcctcccgagttgagaccgatcattcagatagatgggggtaaactaatgagtt
cggatattaatgaactctatagaagagttatctatcgaaataatactcttaccgatctattaacaacaagtagatctacg
ccaggggaattagtaatgtgtcaggaaaaattagtacaagaagccgtggatacacttcttgataatggaatccgcggaca
accaatgagggacggtcataataaggtttacaagtcgttttcagatgtaattgaaggcaaagagggaagatttcgcgaga
ctttgcttggcaaacgagtcgattattcgggacgttctgtcattgttgttggcccctcactttcattacatcgctgtgga
ttgcctcgcgaaatagcaatagagcttttccagacatttgtaattcgcggtctaattagacaacatcttgctccgaacat
aggagttgctaagagtaaaattcgggaaaaagggccgattgtatgggaaatactgcaagaagttatgcggggacatcctg
tattgctgaatagagcgcctactctgcatagattaggtatacaggcattccaacctattttagtggaaggacgcgctatt
tgtttacatccattagtttgtaagggattcaatgcagactttgatggggatcaaatggcagttcatgtacctttatcttt
agaggcgcaagcggaggctcgtttacttatgttttctcatatgaatctcttgtctccagctattggggatcccatttccg
taccgactcaagatatgcttattgggctctatgtattaacgagtgggaatcgtcgaggtatttgtgcgaataggtataat
ccatggaatcgaaaaagctatcaaaatgaaagaattgacgataataactataagtctacaagggagccttttttttgtaa
ttcctatgatgcgattggagcttataggcagaaaagaatcaatttagatagtcctttgtggctccggtggcgactagagc
aatgcgttattgcttcaagagaagctcccatcgaagttcactatgaatctttgggtacctatcatgagatttatggacat
tatctaatagtaagaagtttaaaaaaaaaaattctttgtatatacattcgaaccactgttggtcatatttctctttaccg
agaaatcgaagaagctatacaagggttttttcgggcctactcatatgatacccaatcatatggtatctaa
back to top
>HQ325742.1-rpoC1.m132058
atgatcgaccgatataaacatcaacaactccgaattggatcagtttctccccaacaaataagtgcttgggccaagaaaat
cctacctaatggagaaaccgttggagaggtgacaaaaccctatacttttcattacaaaaccaataaaccggaaaaggatg
gattattttgtgaaagaatttttggacctataaaaagtggaatttgcgcttgtggaaattatcgagtaattggaaatcaa
aaggagggccctaaattttgtgaacaatgcggagttgaatttgttgattctcggatacgaagatatcaaatgggatacat
aaggctggcatgtccagtaactcatgtatggtatttgaaacgtcttcctagttatatcgccaatcttttagacaaacctc
ttaaagaattagagggtctagtatactgcgatttttcttttgctaggcccatcgctaaaaaacctactttcttacgatta
cgaggttcattcgaatatgaaattcaatcctggaaatacagtatcccacttttttttactacccaaggtttcgatacatt
tcgaagtcgcgaaatttctaccggagcaggtgctattcgagaacaattagccgatctagatttgcgaattcttatcgatt
attcggtggtagaatggaaagaattaggagaagaaggcctcacgggtaatgaatgggaagatcgaaaaattggaagaaga
aaggattttttggttagacgcatggaattggctaagcattttattcgaacaaatatagaaccagaatggatggttttatg
tctattaccggttcttcctcccgagttgagaccgatcattcagatagatgggggtaaactaatgagttcggatattaatg
aactctatagaagagttatctatcgaaataatactcttaccgatctattaacaacaagtagatctacgccaggggaatta
gtaatgtgtcaggaaaaattggtacaagaagccgtggatacacttcttgataatggaatccgcggacaaccaatgaggga
cggtcataataaggtttacaagtcgttttcagatgtaattgaaggcaaagagggaagatttcgcgagactttgcttggca
aacgagtcgattattcgggacgttctgtcattgttgttggcccctcactttcattacatcgctgtggattgcctcgcgaa
atagcaatagagcttttccagacatttgtaattcgcggtctaattagacaacatcttgctccgaacataggagttgctaa
gagtaaaattcgggaaaaagggccgattgtatgggaaatactgcaagaagttatgcggggacatcctgtattgctgaata
gagcgcctactctgcatagattaggtatacaggcattccaacctattttagtggaaggacgcgctatttgtttacatcca
ttagtttgtaagggattcaatgcagactttgatggggatcaaatggcagttcatgtacctttatctttagaggcgcaagc
ggaggctcgtttacttatgttttctcatatgaatctcttgtctccagctattggggatcccatttccgtacctactcaag
atatgcttattgggctctatgtattaacgagtgggaatcgtcgaggtatttgtgcgaataggtataatccatggaatcga
aaaagctatcaaaatgaaagaattgacgataataactataagtctacaagggagccttttttttgtaattcctatgatgc
gattggagcttataggcagaaaagaatcaatttagatagtcctttgtggctccggtggcgactagagcaatgcgttattg
cttcaagagaagctcccatcgaagttcactatgaatcttcgggtacctatcatgagatttatggacattatctaatagta
agaagtttaaaaaaaaaaattctttgtatatacattcgaaccactgttggtcatatttctctttaccgagaaatcgaaga
agctatacaagggttttttcgggcctactcatatgatacccaatcatatggtatctaa
back to top
>NC_023215.1-rpoC1.m132070
atgatcgaccgatataaacatcaacaactccgaattggatcagtttctccccaacaaataagtgcttgggccaagaaaat
cctacctaatggagaaaccgttggagaggtgacaaaaccctatacttttcattacaaaaccaataaaccggaaaaggatg
gattattttgtgaaagaatttttggacctataaaaagtggaatttgcgcttgtggaaattatcgagtaattggaaatcaa
aaggagggccctaaattttgtgaacaatgcggagttgaatttgttgattctcggatacgaagatatcaaatgggatacat
aaggctggcatgtccagtaactcatgtatggtatttgaaacgccttcctagttatatcgccaatcttttagacaaacctc
ttaaagaattagagggtctagtatactgcgatgtgtatcctaatttttcttttgctaggcccatcgctaaaaaacctact
ttcttacgattacgaggttcattcgaatatgaaattcaatcctggaaatacagtatcccacttttttttactacccaagg
tttcgatacatttcgaagtcgcgaaatttctaccggagcaggtgctattcgagaacaattagccgatctagatttgcgaa
ttcttatcgattattcggtggtagaatggaaagaattaggagaagaaggcctcacgggtaatgaatgggaagatcgaaaa
attggaagaagaaaggattttttggttagacgcatggaattggctaagcattttattcgaacaaatatagaaccagaatg
gatggttttatgtctattaccggttcttcctcccgagttgagaccgatcattcagatagatgggggtaaactaatgagtt
cggatattaatgaactctatagaagagttatctatcgaaataatactcttaccgatctattaacaacaagtagatctacg
ccaggggaattagtaatgtgtcaggaaaaattagtacaagaagccgtggatacacttcttgataatggaatccgcggaca
accaatgagggacggtcataataaggtttacaagtcgttttcagatgtaattgaaggcaaagagggaagatttcgcgaga
ctttgcttggcaaacgagtcgattattcgggacgttctgtcattgttgttggcccctcactttcattacatcgctgtgga
ttgcctcgcgaaatagcaatagagcttttccagacatttgtaattcgcggtctaattagacaacatcttgctccgaacat
aggagttgctaagagtaaaattcgggaaaaagggccgattgtatgggaaatactgcaagaagttatgcggggacatcctg
tattgctgaatagagcgcctactctgcatagattaggtatacaggcattccaacctattttagtggaaggacgcgctatt
tgtttacatccattagtttgtaagggattcaatgcagactttgatggggatcaaatggcagttcatgtacctttatcttt
agaggcgcaagcggaggctcgtttacttatgttttctcatatgaatctcttgtctccagctattggggatcccatttccg
taccgactcaagatatgcttattgggctctatgtattaacgagtgggaatcgtcgaggtatttgtgcgaataggtataat
ccatggaatcgaaaaagctatcaaaatgaaagaattgacgataataactataagtctacaagggagccttttttttgtaa
ttcctatgatgcgattggagcttataggcagaaaagaatcaatttagatagtcctttgtggctccggtggcgactagagc
aatgcgttattgcttcaagagaagctcccatcgaagttcactatgaatctttgggtacctatcatgagatttatggacat
tatctaatagtaagaagtttaaaaaaaaaaattctttgtatatacattcgaaccactgttggtcatatttctctttaccg
agaaatcgaagaagctatacaagggttttttcgggcctactcatatgatacccaatcatatggtatctaa
back to top
>NC_016692.1-rpoC1.m132058
atgatcgaccgatataaacatcaacaactccgaattggatcagtttctccccaacaaataagtgcttgggccaagaaaat
cctacctaatggagaaaccgttggagaggtgacaaaaccctatacttttcattacaaaaccaataaaccggaaaaggatg
gattattttgtgaaagaatttttggacctataaaaagtggaatttgcgcttgtggaaattatcgagtaattggaaatcaa
aaggagggccctaaattttgtgaacaatgcggagttgaatttgttgattctcggatacgaagatatcaaatgggatacat
aaggctggcatgtccagtaactcatgtatggtatttgaaacgtcttcctagttatatcgccaatcttttagacaaacctc
ttaaagaattagagggtctagtatactgcgatttttcttttgctaggcccatcgctaaaaaacctactttcttacgatta
cgaggttcattcgaatatgaaattcaatcctggaaatacagtatcccacttttttttactacccaaggtttcgatacatt
tcgaagtcgcgaaatttctaccggagcaggtgctattcgagaacaattagccgatctagatttgcgaattcttatcgatt
attcggtggtagaatggaaagaattaggagaagaaggcctcacgggtaatgaatgggaagatcgaaaaattggaagaaga
aaggattttttggttagacgcatggaattggctaagcattttattcgaacaaatatagaaccagaatggatggttttatg
tctattaccggttcttcctcccgagttgagaccgatcattcagatagatgggggtaaactaatgagttcggatattaatg
aactctatagaagagttatctatcgaaataatactcttaccgatctattaacaacaagtagatctacgccaggggaatta
gtaatgtgtcaggaaaaattggtacaagaagccgtggatacacttcttgataatggaatccgcggacaaccaatgaggga
cggtcataataaggtttacaagtcgttttcagatgtaattgaaggcaaagagggaagatttcgcgagactttgcttggca
aacgagtcgattattcgggacgttctgtcattgttgttggcccctcactttcattacatcgctgtggattgcctcgcgaa
atagcaatagagcttttccagacatttgtaattcgcggtctaattagacaacatcttgctccgaacataggagttgctaa
gagtaaaattcgggaaaaagggccgattgtatgggaaatactgcaagaagttatgcggggacatcctgtattgctgaata
gagcgcctactctgcatagattaggtatacaggcattccaacctattttagtggaaggacgcgctatttgtttacatcca
ttagtttgtaagggattcaatgcagactttgatggggatcaaatggcagttcatgtacctttatctttagaggcgcaagc
ggaggctcgtttacttatgttttctcatatgaatctcttgtctccagctattggggatcccatttccgtacctactcaag
atatgcttattgggctctatgtattaacgagtgggaatcgtcgaggtatttgtgcgaataggtataatccatggaatcga
aaaagctatcaaaatgaaagaattgacgataataactataagtctacaagggagccttttttttgtaattcctatgatgc
gattggagcttataggcagaaaagaatcaatttagatagtcctttgtggctccggtggcgactagagcaatgcgttattg
cttcaagagaagctcccatcgaagttcactatgaatcttcgggtacctatcatgagatttatggacattatctaatagta
agaagtttaaaaaaaaaaattctttgtatatacattcgaaccactgttggtcatatttctctttaccgagaaatcgaaga
agctatacaagggttttttcgggcctactcatatgatacccaatcatatggtatctaa
back to top
>JF317353.1-rpoC12819
atgatcgaccgatataaacatcaacaactccgaattggatcagtttctccccaacaaataagtgcttgggccaagaaaat
cctacctaatggagaaaccgttggagaggtgacaaaaccctatacttttcattacaaaaccaataaaccggaaaaggatg
gattattttgtgaaagaatttttggacctataaaaagtggaatttgcgcttgtggaaattatcgagtaattggaaatcaa
aaggagggccctaaattttgtgaacaatgcggagttgaatttgttgattctcggatacgaagatatcaaatgggatacat
aaggctggcatgtccagtaactcatgtatggtatttgaaacgccttcctagttatatcgccaatcttttagacaaacctc
ttaaagaattagagggtctagtatactgcgatgtgtgatttgatcgaaattattattttacagattaggaatgagaaact
gtcatcccattcaatcgaattgggatgccctggatctgacatgtctcttgggaagagtaacatgaagctcagaattatgg
gcgtattcaatactcccaaataaaaagggaattggtctatggtcgagtcagtaaaaataaataactaggaattttgagtt
gtacctcgtgaaaaaaagacttcttttttttgtggaattaaccgttctcatttcttttagttcttttagaaagaaatgaa
attatgttcaaggaaacaaatatgtcatggttgcaggagtctatacatcgcatataggcttaggctttaagttaagggca
tcgtggtataatcgtcgaggtaccgcaggacctaagagatcgaatggaagggtacatagacaagtaaatcccttatgaca
ctcctttaattttagaggattcagcattcgaggggaagtagactactcaagaatttcacatttcatttatgtcctaattt
tgaattgaataaagaattaagaaaatctaaatcaataaatcaataaaagaagaatcaatcaatgaaatgtttcttggaac
ttgagtaaagagtagaccttttttgggggttctagaatttgaaagcgagaactcctttactttatctttatttggtgtaa
ctacttgagccggatgagaggaaactctcatgtccgattttgagggggggatcccgcagggccctatcctaatttttctt
ttgctaggcccatcgctaaaaaacctactttcttacgattacgaggttcattcgaatatgaaattcaatcctggaaatac
agtatcccacttttttttactacccaaggtttcgatacatttcgaagtcgcgaaatttctaccggagcaggtgctattcg
agaacaattagccgatctagatttgcgaattcttatcgattattcggtggtagaatggaaagaattaggagaagaaggcc
tcacgggtaatgaatgggaagatcgaaaaattggaagaagaaaggattttttggttagacgcatggaattggctaagcat
tttattcgaacaaatatagaaccagaatggatggttttatgtctattaccggttcttcctcccgagttgagaccgatcat
tcagatagatgggggtaaactaatgagttcggatattaatgaactctatagaagagttatctatcgaaataatactctta
ccgatctattaacaacaagtagatctacgccaggggaattagtaatgtgtcaggaaaaattagtacaagaagccgtggat
acacttcttgataatggaatccgcggacaaccaatgagggacggtcataataaggtttacaagtcgttttcagatgtaat
tgaaggcaaagagggaagatttcgcgagactttgcttggcaaacgagtcgattattcgggacgttctgtcattgttgttg
gcccctcactttcattacatcgctgtggattgcctcgcgaaatagcaatagagcttttccagacatttgtaattcgcggt
ctaattagacaacatcttgctccgaacataggagttgctaagagtaaaattcgggaaaaagggccgattgtatgggaaat
actgcaagaagttatgcggggacatcctgtattgctgaatagagcgcctactctgcatagattaggtatacaggcattcc
aacctattttagtggaaggacgcgctatttgtttacatccattagtttgtaagggattcaatgcagactttgatggggat
caaatggcagttcatgtacctttatctttagaggcgcaagcggaggctcgtttacttatgttttctcatatgaatctctt
gtctccagctattggggatcccatttccgtaccgactcaagatatgcttattgggctctatgtattaacgagtgggaatc
gtcgaggtatttgtgcgaataggtataatccatggaatcgaaaaagctatcaaaatgaaagaattgacgataataactat
aagtctacaagggagccttttttttgtaattcctatgatgcgattggagcttataggcagaaaagaatcaatttagatag
tcctttgtggctccggtggcgactagagcaatgcgttattgcttcaagagaagctcccatcgaagttcactatgaatctt
tgggtacctatcatgagatttatggacattatctaatagtaagaagtttaaaaaaaaaaattctttgtatatacattcga
accactgttggtcatatttctctttaccgagaaatcgaagaagctatacaagggttttttcgggcctactcatatgatac
ccaatcatatggtatctaa
back to top
>HQ325742.1-rpoC12811
atgatcgaccgatataaacatcaacaactccgaattggatcagtttctccccaacaaataagtgcttgggccaagaaaat
cctacctaatggagaaaccgttggagaggtgacaaaaccctatacttttcattacaaaaccaataaaccggaaaaggatg
gattattttgtgaaagaatttttggacctataaaaagtggaatttgcgcttgtggaaattatcgagtaattggaaatcaa
aaggagggccctaaattttgtgaacaatgcggagttgaatttgttgattctcggatacgaagatatcaaatgggatacat
aaggctggcatgtccagtaactcatgtatggtatttgaaacgtcttcctagttatatcgccaatcttttagacaaacctc
ttaaagaattagagggtctagtatactgcgatgtgtgatttgatcgaaattattattttacagattaggaatgagaaact
gtcatcccattcaatcgaattgggatgccctggatctgacatgtctcttgggaagagtaacatgaagctcagaattatgg
gcgtattcaatactcccaaataaaaagggaattggtctatggtcgagtcagtaaaaataaataactaggaattttgagtt
gtacctcgtgaaaaaaagacttctttttttgtggaattaaccgttctcatttcttttagttcttttagaaagaaatgaaa
ttatgttcaaggaaacaaatatgtcatggttgcaggagtctatacatcgcatataggcttaggctttaagttaagggcat
cgtggtataatcgtcgaggtaccgcaggacctaagagatcgaatggaagggtacatagacaagtaaatcccttatgacac
tcctttaatttaagaggattcagcattcgaggggaagtagactactcaagaatttcacatttcatttatgtcctaatttt
gaattgaataaagaattaagaaaatctaaatcaataaaagaagaatcaatcaatgaaatgtttcttggaacttgagtaaa
gagtagacctttttgggggggttctagaatttgaaagcgagaactcctttactttatctttatttggtgtaactacttga
gccggatgagaggaaactctcatgtccgattttgagggggggatcccgcagggccctatcctaatttttcttttgctagg
cccatcgctaaaaaacctactttcttacgattacgaggttcattcgaatatgaaattcaatcctggaaatacagtatccc
acttttttttactacccaaggtttcgatacatttcgaagtcgcgaaatttctaccggagcaggtgctattcgagaacaat
tagccgatctagatttgcgaattcttatcgattattcggtggtagaatggaaagaattaggagaagaaggcctcacgggt
aatgaatgggaagatcgaaaaattggaagaagaaaggattttttggttagacgcatggaattggctaagcattttattcg
aacaaatatagaaccagaatggatggttttatgtctattaccggttcttcctcccgagttgagaccgatcattcagatag
atgggggtaaactaatgagttcggatattaatgaactctatagaagagttatctatcgaaataatactcttaccgatcta
ttaacaacaagtagatctacgccaggggaattagtaatgtgtcaggaaaaattggtacaagaagccgtggatacacttct
tgataatggaatccgcggacaaccaatgagggacggtcataataaggtttacaagtcgttttcagatgtaattgaaggca
aagagggaagatttcgcgagactttgcttggcaaacgagtcgattattcgggacgttctgtcattgttgttggcccctca
ctttcattacatcgctgtggattgcctcgcgaaatagcaatagagcttttccagacatttgtaattcgcggtctaattag
acaacatcttgctccgaacataggagttgctaagagtaaaattcgggaaaaagggccgattgtatgggaaatactgcaag
aagttatgcggggacatcctgtattgctgaatagagcgcctactctgcatagattaggtatacaggcattccaacctatt
ttagtggaaggacgcgctatttgtttacatccattagtttgtaagggattcaatgcagactttgatggggatcaaatggc
agttcatgtacctttatctttagaggcgcaagcggaggctcgtttacttatgttttctcatatgaatctcttgtctccag
ctattggggatcccatttccgtacctactcaagatatgcttattgggctctatgtattaacgagtgggaatcgtcgaggt
atttgtgcgaataggtataatccatggaatcgaaaaagctatcaaaatgaaagaattgacgataataactataagtctac
aagggagccttttttttgtaattcctatgatgcgattggagcttataggcagaaaagaatcaatttagatagtcctttgt
ggctccggtggcgactagagcaatgcgttattgcttcaagagaagctcccatcgaagttcactatgaatcttcgggtacc
tatcatgagatttatggacattatctaatagtaagaagtttaaaaaaaaaaattctttgtatatacattcgaaccactgt
tggtcatatttctctttaccgagaaatcgaagaagctatacaagggttttttcgggcctactcatatgatacccaatcat
atggtatctaa
back to top
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
rpoC1NC_023215.1-rpoC1Gossypium herbaceumgene
rpoC1NC_016692.1-rpoC1Gossypium herbaceumgene
rpoC1JF317353.1-rpoC1Gossypium herbaceumgene
rpoC1HQ325742.1-rpoC1Gossypium herbaceumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
rpoC1JF317353.1-rpoC1.m13Gossypium herbaceummRNA
rpoC1HQ325742.1-rpoC1.m13Gossypium herbaceummRNA
rpoC1NC_023215.1-rpoC1.m13Gossypium herbaceummRNA
rpoC1NC_016692.1-rpoC1.m13Gossypium herbaceummRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
CottonGen Gene Database2017-09-06