rpoC2, rpoC2 (gene) Gossypium herbaceum

Gene Overview
Name rpoC2
Gene Symbol rpoC2
Type gene
Organism Gossypium herbaceum
Synonym RNA polymerase beta subunit
RNA polymerase beta'' subunit
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Name Genome Location NCBI Accession
NC_023215.1-rpoC2 N/A NC_023215.1
NC_016692.1-rpoC2 N/A NC_016692.1
JF317353.1-rpoC2.m12 N/A JF317353.1
HQ325742.1-rpoC2.m12 N/A HQ325742.1
NC_023215.1-rpoC2.m12 N/A NC_023215.1
NC_016692.1-rpoC2.m12 N/A NC_016692.1
JF317353.1-rpoC2 N/A JF317353.1
HQ325742.1-rpoC2 N/A HQ325742.1

Sequence(s):
>NC_023215.1-rpoC24182
atggcagaacgggccaatctggtatttcacaataaagtgatagatggaactgccattaaacggcttattagcagattaat
agatcacttcggaatggcatatacatcacacatcctggatcaagtaaaagctctgggtttccagcaagccactgctacat
ccatttcattaggaattgatgatcttttaacgataccttctaagggatggctagtccaagatgctgaacaacaaagtttg
attttggaaaaacaccatcattttgggaatgtacacgcggtagaaaaattacgccaatcaattgagatatggtatgctac
aagtgaatatttgcgacaagaaatgaatcctaattttaggatgactgacccgtttaacccagtccatataatgtcttttt
caggagctagaggaaatgcatctcaagtgcaccaattagtaggtatgagaggattaatgtcggatccccaaggacaaatg
atcgatttacccattcaaagcaatttacgcgaaggactgtctttaacagaatatatcatttcttgctacggagcccgaaa
aggggttgtggataccgccgtacgaacatcagatgctggatatcttacgcgcagacttgttgaagtagttcaacacattg
ttgtacgtagaacagattgtggcaccacccgagggatttctgtgagtcctcaaaagaggacgcttccagaaagaattttt
atccaaacattaattggtcgtgtattagcggacgatatatatatgggtccgcggtgcattgccattcgaaatcaagatat
tgggcttgggcttgtcgatcgattcagagcctttcgaacacaaccaatatctattcgaactccctttacttgtaggagta
catcttggatttgtcgattatgttatggtcggagccccactcatggtgacctggttgaattgggagaagctgtaggtatt
attgcggggcaatccattggagaaccgggaacgcaactaacattaagaacttttcataccggcggagtatttacaggggg
tactgcagaacatgtacgagccccttttaatggaaaaatcaaattcaatgaggatttggttcatcctacacgcacacgtc
acgggcatcctgcttttttatgttatcaggacttgtatgtaattattgagagcgaagatattatacataaggtgactatt
ccaccaaaaagttttcttttagttcaaaacgatcaatatgtagaatcagaacaagtgattgctgagattcgcgcgggaac
atacactttaaatttgaaagagagggttcgaaaacatatttattctgactcagagggggaaatgcactggagtaccgatg
tgtaccattcgcccgaatttacatatagtaatgtccatctcttaccaaaaacaagccatttgtggatattatcagggggt
tcgtacaaattcagtgtagttcctttttcgctccacaaagatcaagatcaaataaacattcattatctttctgccgaacg
aagatatatttctagattctcagtgaataatgatcaagtgagacacaacttatttagttcggatttttcggataaaaaag
aagataggatttacgattattcagaattgaatcgaataataggtactgggcattgtgatttcatatattctgctattctc
cacgagaatgctgatttattggcaaagagacgaagaaatagatttattattccatttcaattgattcaagaccaagagaa
agaactaatgctgcattcccattccggtatctcgatcgaaatacccataaatggtattttccgtagaaaaagtattcttg
ctttttttgacgatcctcgatacagaagaaagagttcaggaattactaaatatgggactctaggggcgcattcaatcgtc
aaaagggaggatgtgattgagtatcgaggagtcaaaaaggttaagccaaaataccaaatgaaagtagatcgatttttttt
cattcccgaggaagtgcatattttatccgaatcttcttccataatggtacggaacaatagtatcattggagtagataccc
aaatcactttaaatacaagaagccaagtgggcggattggtccgagtggaaagaaaaaaaaaaaggattgaactgaaaatt
ttttcgggtaatatctattttcccggagaaagagataagatatctcgacacagtggcatcttgataccaccaggaacggg
caaaacaaactctaaggaatcaaaaaaattgaaaaattggatctatgtccaacggatcacacctaccaagaaaaagtatt
ttgttttggttcgacctgtaaccccatatgaaataccggacggtctaaatttagcaacactcttcccccaggatccattt
cgggaaaaagataatatgcaacttcgagctgtcaattatatcctttatggaaatggcaaaccgactcggagaatttctga
cacaagtattcaactagttcggacttgtttagtgttgagttgggaccaagacaacaaaagttctttcgccgaagaggtct
gtgcttcctttgttgaagtaaggacaaatggtctgattcgagatttcctaagaatcgacttagtgaaatctcatattttt
tatatcagaaaaagaaatgatccgtcaggttcagaattgatttctgataataggtcagatcgtaccaataaaaatccgtt
ttattccatttattccaacgcaaggattcaacaatcgtttagccaaaatcacggaactattcatacgctcttgaacagaa
ataaggaatcccaatctttgataattttgtcatcatctaattgttttcgcatgggcccattcaacgatgtaaaatatcac
aatgtgataaaacaatcaattaaaaaagatcctctaattccaattaagaatttattgggtcctttaggaacagcccccaa
aattgcgaatttttattcatcattttaccctttaataactcataatcagacctcggtagcgaaatatttggagcttgaca
atttaaaacaggcttttcaagtacttaactattatttaatagctgaaaatgggagaatttataatttcgatccatgccgt
aacatctttttgaatgcagtcaatttgaattggtattttccccatcatcattatcatcataattattgtgaagaaacgtc
cacaataattagtcttgggcagtttatttgtgaaaatgtatgtatagccaaaagcggaccacgcctaaaatcgggtcaag
tttttattgttcaagctgattctatagtaataagatcggctaagccttatttggcgactccgggagcaactgtccatggg
cattatggagaaatcctttacgaaggagatacgttagttacatttatatatgaaaaatcgagatctggtgatataacgca
gggtcttccaaaagtggaacaagtgttagaagtgcgttcgattgattcaatatcgatgaacctagaaaagagaattgagg
gttggaacgaatgtataacaagaattcttggaattccttggggattcgtgattggtgctgagctaactatagtgcaaagt
cgtctctctttggttaataagatccaaaaggtttatcgatctcagggggtacagatccataataggcatatagaaattat
tgtacgtcaaataacatcaaaagtattggtttcagaagatggaatgtctaatgtttttttacccggggaactgattggat
tattgcgagcggaacgaacggggcgtgctttagaagaagcgatttgttatcgagccgttttattgggaataacgagagca
tctctgaacactcaaagttttatatctgaagcaagttttcaagaaactgctcgagttttagcaaaagctgctctccgggg
tcgtatcgattggttgaaaggcctgaaagaaaacgttgtgcttgggggtatgatacccgccggtaccggattcaaaggat
tagtgcaccggtcacggcaacataacaacattcttttggaaacaaaaaaaaagaatttcttcgggggagaaatgagagat
attttcttccaccaccgagaattatttgactcttgcatttcaaacaatttacatgatacatcaggccgctcttttatagg
tatagaatttaatgattcttaa
back to top
>NC_016692.1-rpoC24182
atggcagaacgggccaatctggtatttcacaataaagtgatagatggaactgccattaaacggcttattagcagattaat
agatcacttcggaatggcatatacatcacacatcctggatcaagtaaaagctctgggtttccagcaagccactgctacat
ccatttcattaggaattgatgatcttttaacgataccttctaagggatggctagtccaagatgctgaacaacaaagtttg
attttggaaaaacaccatcattttgggaatgtacacgcggtagaaaaattacgccaatcaattgagatatggtatgctac
aagtgaatatttgcgacaagaaatgaatcctaattttaggatgactgacccgtttaacccagtccatataatgtcttttt
caggagctagaggaaatgcatctcaagtgcaccaattagtaggtatgagaggattaatgtcggatccccaaggacaaatg
atcgatttacccattcaaagcaatttacgcgaaggactgtctttaacagaatatatcatttcttgctacggagcccgaaa
aggggttgtggataccgccgtacgaacatcagatgctggatatcttacgcgcagacttgttgaagtagttcaacacattg
ttgtacgtagaacagattgtggcaccacccgagggatttctgtgagtcctcaaaagaggacgcttccggaaagaattttt
atccaaacattaattggtcgtgtattagcggacgatatatatatgggtccgcggtgcattgccattcgaaatcaagatat
tgggcttgggcttgtcgatcgattcagagcctttcgaacacaaccaatatctattcgaactccctttacttgtaggagta
catcttggatttgtcgattatgttatggtcggagccccactcatggtgacctggttgaattgggagaagctgtaggtatt
attgcggggcaatccattggagaaccgggaacgcaactaacattaagaacttttcataccggcggagtatttacaggggg
tactgcagaacatgtccgagccccttttaatggaaaaataaaattcaatgaggatttggttcatcctacacgcacacgtc
acgggcatcctgcttttttatgttatcgggacttgtatgtaattattgagagtgaagatattatacataaggtgactatt
ccaccaaaaagttttcttttagttcaaaacgatcaatatgtagaatcagaacaagtgattgctgagattcgcgcgggaac
atacactttaaatttgaaagagagggttcgaaaacatatttattctgactcagagggggaaatgcactggagtaccgatg
tgtaccattcgcccgaatttacatatagtaatgtccatctcttaccaaaaacaagccatttgtggatattatcagggggt
tcgtacaaattcagtgtagttcctttttcgctccacaaggatcaagatcaaataaacattcattatctttctgccgaacg
aagatatatttctagattctcagtgaataatgatcaagtgagacacaacttatttagttcggatttttcggataaaaaag
aagagaggatttacgattattcagaattgaatcgaataataggtactgggcattgtgatttcatatattctgctattctc
cacgagaatgctgatttattggcaaagagacgaagaaatagatttattattccatttcaattgattcaagaccaagagaa
agaactaatgctacattcccattccggtatctcgatggaaatacccataaatggtattttccgtagaaaaagtattcttg
ctttttttgacgatcctcgatacagaagaaagagttcaggaattactaaatatgggactctaggggcgcattcaatcgtc
aaaagggaggatgtgattgagtatcgaggagtcaaaaaggttaagccaaaataccaaatgaaagtagatcgatttttttt
cattcccgaggaagtgcatattttatccgaatcttcttccataatggtacggaacaatagtatcattggagtagataccc
caatcactttaaatacaagaagccaagtgggcggattggtccgagtggaaagaaaaaaaaaaaggattgaactgaaaatt
ttttcgggtaatatctattttcccggagaaagagataagatatctcgacacagtggcatcttgataccaccaggaacggg
caaaacaaactctaaggaatcaaaaaaattgaaaaaatggatctatgtccaacggatcacacctaccaagaaaaagtatt
ttgttttggttcgacctgtaaccccatatgaaataccggacggtctaaatttagcaacactcttcccccaggatccattt
caggaaaaagataatatgcaacttcgagctgtcaattatatcctttatggaaatggcaaaccgactcggagaatttctga
cacaagtattcaactagttcggacttgtttagtgttgagttgggaccaagacaacaaaagttctttcgccgaagaggtct
gtgcttcctttgttgaagtaaggacaaatggtctgattcgagatttcctaagaatcgacttagtgaaatctcatattttt
tatatcagaaaaagaaatgatccgtcaggttcagaattgatttctgataataggtcagatcgtaccaataaaaatccgtt
ttattccatttattccaacgcaaggattcaacaatcgtttagccaaaatcacggaactattcatacgctcttgaacagaa
ataaggaatcccaatctttgataattttgtcagcatctaattgttttcgcatgggcccattcaacgatgtaaaatatcac
aatgtgataaaacaatcaattaaaaaagatcctctaattccaattaagaatttattgggtcctttaggaacagcccccaa
aattgcgaatttttattcatcattttaccctttaataactcataatcagacctcggtagcgaaatattttgagcttgaca
atttaaaacaggcttttcaagtacttaactattatttaatagctgaaaatgggagaatttataatttcgatccatgccgt
aacatctttttgaatgcagtcaatttgaattggtattttccccatcatcattatcatcataattattgtgaagaaacgtc
cacaataattagtcttgggcagtttatttgtgaaaatgtatgtatagccaaaagcggaccacgcctaaaatcgggtcaag
tttttattgttcaagctgattctatagtaataagatcggctaagccttatttggcgactccgggagcaactgtccatggg
cattatggagaaaccctttacgaaggagatacgttagttacatttatatatgaaaaatcgagatctggtgatataacgca
gggtcttccaaaagtggaacaagtgttagaagtgcgttcgattgattcaatatcgatgaacctagaaaagagaattgagg
gttggaacgaatgtataacaagaattcttggaattccttggggattcgtgattggtgctgagctaactatagtgcaaagt
cgtctctctttggttaataagatccaaaaggtttatcgatctcagggggtacagatccataataggcatatagaaattat
tgtacgtcaaataacatcaaaagtattggtttcagaagatggaatgtctaatgtttttttacccggggaactgattggat
tattgcgagcggaacgaacggggcgtgctttagaagaagcgatttgttatcgagccgttttattgggaataacgagagca
tctctgaacactcaaagttttatatctgaagcaagttttcaagaaactgctcgagttttagcaaaagctgctctccgggg
tcgtatcgattggttgaaaggcctgaaagaaaacgttgtgcttgggggtatgatacccgccggtaccggattcaaaggat
tagtgcaccggtcacggcaacataacaacattcttttggaaacaaaaaaaaagaatttcttcgggggagaaatgagagat
attttcttccaccaccgagaattatttgactcttgcatttcaaacaatttacatgatacatcaggccgctcttttatagg
tatagaatttaatgattcttaa
back to top
>JF317353.1-rpoC2.m124182
atggcagaacgggccaatctggtatttcacaataaagtgatagatggaactgccattaaacggcttattagcagattaat
agatcacttcggaatggcatatacatcacacatcctggatcaagtaaaagctctgggtttccagcaagccactgctacat
ccatttcattaggaattgatgatcttttaacgataccttctaagggatggctagtccaagatgctgaacaacaaagtttg
attttggaaaaacaccatcattttgggaatgtacacgcggtagaaaaattacgccaatcaattgagatatggtatgctac
aagtgaatatttgcgacaagaaatgaatcctaattttaggatgactgacccgtttaacccagtccatataatgtcttttt
caggagctagaggaaatgcatctcaagtgcaccaattagtaggtatgagaggattaatgtcggatccccaaggacaaatg
atcgatttacccattcaaagcaatttacgcgaaggactgtctttaacagaatatatcatttcttgctacggagcccgaaa
aggggttgtggataccgccgtacgaacatcagatgctggatatcttacgcgcagacttgttgaagtagttcaacacattg
ttgtacgtagaacagattgtggcaccacccgagggatttctgtgagtcctcaaaagaggacgcttccagaaagaattttt
atccaaacattaattggtcgtgtattagcggacgatatatatatgggtccgcggtgcattgccattcgaaatcaagatat
tgggcttgggcttgtcgatcgattcagagcctttcgaacacaaccaatatctattcgaactccctttacttgtaggagta
catcttggatttgtcgattatgttatggtcggagccccactcatggtgacctggttgaattgggagaagctgtaggtatt
attgcggggcaatccattggagaaccgggaacgcaactaacattaagaacttttcataccggcggagtatttacaggggg
tactgcagaacatgtacgagccccttttaatggaaaaatcaaattcaatgaggatttggttcatcctacacgcacacgtc
acgggcatcctgcttttttatgttatcaggacttgtatgtaattattgagagcgaagatattatacataaggtgactatt
ccaccaaaaagttttcttttagttcaaaacgatcaatatgtagaatcagaacaagtgattgctgagattcgcgcgggaac
atacactttaaatttgaaagagagggttcgaaaacatatttattctgactcagagggggaaatgcactggagtaccgatg
tgtaccattcgcccgaatttacatatagtaatgtccatctcttaccaaaaacaagccatttgtggatattatcagggggt
tcgtacaaattcagtgtagttcctttttcgctccacaaagatcaagatcaaataaacattcattatctttctgccgaacg
aagatatatttctagattctcagtgaataatgatcaagtgagacacaacttatttagttcggatttttcggataaaaaag
aagataggatttacgattattcagaattgaatcgaataataggtactgggcattgtgatttcatatattctgctattctc
cacgagaatgctgatttattggcaaagagacgaagaaatagatttattattccatttcaattgattcaagaccaagagaa
agaactaatgctgcattcccattccggtatctcgatcgaaatacccataaatggtattttccgtagaaaaagtattcttg
ctttttttgacgatcctcgatacagaagaaagagttcaggaattactaaatatgggactctaggggcgcattcaatcgtc
aaaagggaggatgtgattgagtatcgaggagtcaaaaaggttaagccaaaataccaaatgaaagtagatcgatttttttt
cattcccgaggaagtgcatattttatccgaatcttcttccataatggtacggaacaatagtatcattggagtagataccc
aaatcactttaaatacaagaagccaagtgggcggattggtccgagtggaaagaaaaaaaaaaaggattgaactgaaaatt
ttttcgggtaatatctattttcccggagaaagagataagatatctcgacacagtggcatcttgataccaccaggaacggg
caaaacaaactctaaggaatcaaaaaaattgaaaaattggatctatgtccaacggatcacacctaccaagaaaaagtatt
ttgttttggttcgacctgtaaccccatatgaaataccggacggtctaaatttagcaacactcttcccccaggatccattt
cgggaaaaagataatatgcaacttcgagctgtcaattatatcctttatggaaatggcaaaccgactcggagaatttctga
cacaagtattcaactagttcggacttgtttagtgttgagttgggaccaagacaacaaaagttctttcgccgaagaggtct
gtgcttcctttgttgaagtaaggacaaatggtctgattcgagatttcctaagaatcgacttagtgaaatctcatattttt
tatatcagaaaaagaaatgatccgtcaggttcagaattgatttctgataataggtcagatcgtaccaataaaaatccgtt
ttattccatttattccaacgcaaggattcaacaatcgtttagccaaaatcacggaactattcatacgctcttgaacagaa
ataaggaatcccaatctttgataattttgtcatcatctaattgttttcgcatgggcccattcaacgatgtaaaatatcac
aatgtgataaaacaatcaattaaaaaagatcctctaattccaattaagaatttattgggtcctttaggaacagcccccaa
aattgcgaatttttattcatcattttaccctttaataactcataatcagacctcggtagcgaaatatttggagcttgaca
atttaaaacaggcttttcaagtacttaactattatttaatagctgaaaatgggagaatttataatttcgatccatgccgt
aacatctttttgaatgcagtcaatttgaattggtattttccccatcatcattatcatcataattattgtgaagaaacgtc
cacaataattagtcttgggcagtttatttgtgaaaatgtatgtatagccaaaagcggaccacgcctaaaatcgggtcaag
tttttattgttcaagctgattctatagtaataagatcggctaagccttatttggcgactccgggagcaactgtccatggg
cattatggagaaatcctttacgaaggagatacgttagttacatttatatatgaaaaatcgagatctggtgatataacgca
gggtcttccaaaagtggaacaagtgttagaagtgcgttcgattgattcaatatcgatgaacctagaaaagagaattgagg
gttggaacgaatgtataacaagaattcttggaattccttggggattcgtgattggtgctgagctaactatagtgcaaagt
cgtctctctttggttaataagatccaaaaggtttatcgatctcagggggtacagatccataataggcatatagaaattat
tgtacgtcaaataacatcaaaagtattggtttcagaagatggaatgtctaatgtttttttacccggggaactgattggat
tattgcgagcggaacgaacggggcgtgctttagaagaagcgatttgttatcgagccgttttattgggaataacgagagca
tctctgaacactcaaagttttatatctgaagcaagttttcaagaaactgctcgagttttagcaaaagctgctctccgggg
tcgtatcgattggttgaaaggcctgaaagaaaacgttgtgcttgggggtatgatacccgccggtaccggattcaaaggat
tagtgcaccggtcacggcaacataacaacattcttttggaaacaaaaaaaaagaatttcttcgggggagaaatgagagat
attttcttccaccaccgagaattatttgactcttgcatttcaaacaatttacatgatacatcaggccgctcttttatagg
tatagaatttaatgattcttaa
back to top
>HQ325742.1-rpoC2.m124182
atggcagaacgggccaatctggtatttcacaataaagtgatagatggaactgccattaaacggcttattagcagattaat
agatcacttcggaatggcatatacatcacacatcctggatcaagtaaaagctctgggtttccagcaagccactgctacat
ccatttcattaggaattgatgatcttttaacgataccttctaagggatggctagtccaagatgctgaacaacaaagtttg
attttggaaaaacaccatcattttgggaatgtacacgcggtagaaaaattacgccaatcaattgagatatggtatgctac
aagtgaatatttgcgacaagaaatgaatcctaattttaggatgactgacccgtttaacccagtccatataatgtcttttt
caggagctagaggaaatgcatctcaagtgcaccaattagtaggtatgagaggattaatgtcggatccccaaggacaaatg
atcgatttacccattcaaagcaatttacgcgaaggactgtctttaacagaatatatcatttcttgctacggagcccgaaa
aggggttgtggataccgccgtacgaacatcagatgctggatatcttacgcgcagacttgttgaagtagttcaacacattg
ttgtacgtagaacagattgtggcaccacccgagggatttctgtgagtcctcaaaagaggacgcttccggaaagaattttt
atccaaacattaattggtcgtgtattagcggacgatatatatatgggtccgcggtgcattgccattcgaaatcaagatat
tgggcttgggcttgtcgatcgattcagagcctttcgaacacaaccaatatctattcgaactccctttacttgtaggagta
catcttggatttgtcgattatgttatggtcggagccccactcatggtgacctggttgaattgggagaagctgtaggtatt
attgcggggcaatccattggagaaccgggaacgcaactaacattaagaacttttcataccggcggagtatttacaggggg
tactgcagaacatgtccgagccccttttaatggaaaaataaaattcaatgaggatttggttcatcctacacgcacacgtc
acgggcatcctgcttttttatgttatcgggacttgtatgtaattattgagagtgaagatattatacataaggtgactatt
ccaccaaaaagttttcttttagttcaaaacgatcaatatgtagaatcagaacaagtgattgctgagattcgcgcgggaac
atacactttaaatttgaaagagagggttcgaaaacatatttattctgactcagagggggaaatgcactggagtaccgatg
tgtaccattcgcccgaatttacatatagtaatgtccatctcttaccaaaaacaagccatttgtggatattatcagggggt
tcgtacaaattcagtgtagttcctttttcgctccacaaggatcaagatcaaataaacattcattatctttctgccgaacg
aagatatatttctagattctcagtgaataatgatcaagtgagacacaacttatttagttcggatttttcggataaaaaag
aagagaggatttacgattattcagaattgaatcgaataataggtactgggcattgtgatttcatatattctgctattctc
cacgagaatgctgatttattggcaaagagacgaagaaatagatttattattccatttcaattgattcaagaccaagagaa
agaactaatgctacattcccattccggtatctcgatggaaatacccataaatggtattttccgtagaaaaagtattcttg
ctttttttgacgatcctcgatacagaagaaagagttcaggaattactaaatatgggactctaggggcgcattcaatcgtc
aaaagggaggatgtgattgagtatcgaggagtcaaaaaggttaagccaaaataccaaatgaaagtagatcgatttttttt
cattcccgaggaagtgcatattttatccgaatcttcttccataatggtacggaacaatagtatcattggagtagataccc
caatcactttaaatacaagaagccaagtgggcggattggtccgagtggaaagaaaaaaaaaaaggattgaactgaaaatt
ttttcgggtaatatctattttcccggagaaagagataagatatctcgacacagtggcatcttgataccaccaggaacggg
caaaacaaactctaaggaatcaaaaaaattgaaaaaatggatctatgtccaacggatcacacctaccaagaaaaagtatt
ttgttttggttcgacctgtaaccccatatgaaataccggacggtctaaatttagcaacactcttcccccaggatccattt
caggaaaaagataatatgcaacttcgagctgtcaattatatcctttatggaaatggcaaaccgactcggagaatttctga
cacaagtattcaactagttcggacttgtttagtgttgagttgggaccaagacaacaaaagttctttcgccgaagaggtct
gtgcttcctttgttgaagtaaggacaaatggtctgattcgagatttcctaagaatcgacttagtgaaatctcatattttt
tatatcagaaaaagaaatgatccgtcaggttcagaattgatttctgataataggtcagatcgtaccaataaaaatccgtt
ttattccatttattccaacgcaaggattcaacaatcgtttagccaaaatcacggaactattcatacgctcttgaacagaa
ataaggaatcccaatctttgataattttgtcagcatctaattgttttcgcatgggcccattcaacgatgtaaaatatcac
aatgtgataaaacaatcaattaaaaaagatcctctaattccaattaagaatttattgggtcctttaggaacagcccccaa
aattgcgaatttttattcatcattttaccctttaataactcataatcagacctcggtagcgaaatattttgagcttgaca
atttaaaacaggcttttcaagtacttaactattatttaatagctgaaaatgggagaatttataatttcgatccatgccgt
aacatctttttgaatgcagtcaatttgaattggtattttccccatcatcattatcatcataattattgtgaagaaacgtc
cacaataattagtcttgggcagtttatttgtgaaaatgtatgtatagccaaaagcggaccacgcctaaaatcgggtcaag
tttttattgttcaagctgattctatagtaataagatcggctaagccttatttggcgactccgggagcaactgtccatggg
cattatggagaaaccctttacgaaggagatacgttagttacatttatatatgaaaaatcgagatctggtgatataacgca
gggtcttccaaaagtggaacaagtgttagaagtgcgttcgattgattcaatatcgatgaacctagaaaagagaattgagg
gttggaacgaatgtataacaagaattcttggaattccttggggattcgtgattggtgctgagctaactatagtgcaaagt
cgtctctctttggttaataagatccaaaaggtttatcgatctcagggggtacagatccataataggcatatagaaattat
tgtacgtcaaataacatcaaaagtattggtttcagaagatggaatgtctaatgtttttttacccggggaactgattggat
tattgcgagcggaacgaacggggcgtgctttagaagaagcgatttgttatcgagccgttttattgggaataacgagagca
tctctgaacactcaaagttttatatctgaagcaagttttcaagaaactgctcgagttttagcaaaagctgctctccgggg
tcgtatcgattggttgaaaggcctgaaagaaaacgttgtgcttgggggtatgatacccgccggtaccggattcaaaggat
tagtgcaccggtcacggcaacataacaacattcttttggaaacaaaaaaaaagaatttcttcgggggagaaatgagagat
attttcttccaccaccgagaattatttgactcttgcatttcaaacaatttacatgatacatcaggccgctcttttatagg
tatagaatttaatgattcttaa
back to top
>NC_023215.1-rpoC2.m124182
atggcagaacgggccaatctggtatttcacaataaagtgatagatggaactgccattaaacggcttattagcagattaat
agatcacttcggaatggcatatacatcacacatcctggatcaagtaaaagctctgggtttccagcaagccactgctacat
ccatttcattaggaattgatgatcttttaacgataccttctaagggatggctagtccaagatgctgaacaacaaagtttg
attttggaaaaacaccatcattttgggaatgtacacgcggtagaaaaattacgccaatcaattgagatatggtatgctac
aagtgaatatttgcgacaagaaatgaatcctaattttaggatgactgacccgtttaacccagtccatataatgtcttttt
caggagctagaggaaatgcatctcaagtgcaccaattagtaggtatgagaggattaatgtcggatccccaaggacaaatg
atcgatttacccattcaaagcaatttacgcgaaggactgtctttaacagaatatatcatttcttgctacggagcccgaaa
aggggttgtggataccgccgtacgaacatcagatgctggatatcttacgcgcagacttgttgaagtagttcaacacattg
ttgtacgtagaacagattgtggcaccacccgagggatttctgtgagtcctcaaaagaggacgcttccagaaagaattttt
atccaaacattaattggtcgtgtattagcggacgatatatatatgggtccgcggtgcattgccattcgaaatcaagatat
tgggcttgggcttgtcgatcgattcagagcctttcgaacacaaccaatatctattcgaactccctttacttgtaggagta
catcttggatttgtcgattatgttatggtcggagccccactcatggtgacctggttgaattgggagaagctgtaggtatt
attgcggggcaatccattggagaaccgggaacgcaactaacattaagaacttttcataccggcggagtatttacaggggg
tactgcagaacatgtacgagccccttttaatggaaaaatcaaattcaatgaggatttggttcatcctacacgcacacgtc
acgggcatcctgcttttttatgttatcaggacttgtatgtaattattgagagcgaagatattatacataaggtgactatt
ccaccaaaaagttttcttttagttcaaaacgatcaatatgtagaatcagaacaagtgattgctgagattcgcgcgggaac
atacactttaaatttgaaagagagggttcgaaaacatatttattctgactcagagggggaaatgcactggagtaccgatg
tgtaccattcgcccgaatttacatatagtaatgtccatctcttaccaaaaacaagccatttgtggatattatcagggggt
tcgtacaaattcagtgtagttcctttttcgctccacaaagatcaagatcaaataaacattcattatctttctgccgaacg
aagatatatttctagattctcagtgaataatgatcaagtgagacacaacttatttagttcggatttttcggataaaaaag
aagataggatttacgattattcagaattgaatcgaataataggtactgggcattgtgatttcatatattctgctattctc
cacgagaatgctgatttattggcaaagagacgaagaaatagatttattattccatttcaattgattcaagaccaagagaa
agaactaatgctgcattcccattccggtatctcgatcgaaatacccataaatggtattttccgtagaaaaagtattcttg
ctttttttgacgatcctcgatacagaagaaagagttcaggaattactaaatatgggactctaggggcgcattcaatcgtc
aaaagggaggatgtgattgagtatcgaggagtcaaaaaggttaagccaaaataccaaatgaaagtagatcgatttttttt
cattcccgaggaagtgcatattttatccgaatcttcttccataatggtacggaacaatagtatcattggagtagataccc
aaatcactttaaatacaagaagccaagtgggcggattggtccgagtggaaagaaaaaaaaaaaggattgaactgaaaatt
ttttcgggtaatatctattttcccggagaaagagataagatatctcgacacagtggcatcttgataccaccaggaacggg
caaaacaaactctaaggaatcaaaaaaattgaaaaattggatctatgtccaacggatcacacctaccaagaaaaagtatt
ttgttttggttcgacctgtaaccccatatgaaataccggacggtctaaatttagcaacactcttcccccaggatccattt
cgggaaaaagataatatgcaacttcgagctgtcaattatatcctttatggaaatggcaaaccgactcggagaatttctga
cacaagtattcaactagttcggacttgtttagtgttgagttgggaccaagacaacaaaagttctttcgccgaagaggtct
gtgcttcctttgttgaagtaaggacaaatggtctgattcgagatttcctaagaatcgacttagtgaaatctcatattttt
tatatcagaaaaagaaatgatccgtcaggttcagaattgatttctgataataggtcagatcgtaccaataaaaatccgtt
ttattccatttattccaacgcaaggattcaacaatcgtttagccaaaatcacggaactattcatacgctcttgaacagaa
ataaggaatcccaatctttgataattttgtcatcatctaattgttttcgcatgggcccattcaacgatgtaaaatatcac
aatgtgataaaacaatcaattaaaaaagatcctctaattccaattaagaatttattgggtcctttaggaacagcccccaa
aattgcgaatttttattcatcattttaccctttaataactcataatcagacctcggtagcgaaatatttggagcttgaca
atttaaaacaggcttttcaagtacttaactattatttaatagctgaaaatgggagaatttataatttcgatccatgccgt
aacatctttttgaatgcagtcaatttgaattggtattttccccatcatcattatcatcataattattgtgaagaaacgtc
cacaataattagtcttgggcagtttatttgtgaaaatgtatgtatagccaaaagcggaccacgcctaaaatcgggtcaag
tttttattgttcaagctgattctatagtaataagatcggctaagccttatttggcgactccgggagcaactgtccatggg
cattatggagaaatcctttacgaaggagatacgttagttacatttatatatgaaaaatcgagatctggtgatataacgca
gggtcttccaaaagtggaacaagtgttagaagtgcgttcgattgattcaatatcgatgaacctagaaaagagaattgagg
gttggaacgaatgtataacaagaattcttggaattccttggggattcgtgattggtgctgagctaactatagtgcaaagt
cgtctctctttggttaataagatccaaaaggtttatcgatctcagggggtacagatccataataggcatatagaaattat
tgtacgtcaaataacatcaaaagtattggtttcagaagatggaatgtctaatgtttttttacccggggaactgattggat
tattgcgagcggaacgaacggggcgtgctttagaagaagcgatttgttatcgagccgttttattgggaataacgagagca
tctctgaacactcaaagttttatatctgaagcaagttttcaagaaactgctcgagttttagcaaaagctgctctccgggg
tcgtatcgattggttgaaaggcctgaaagaaaacgttgtgcttgggggtatgatacccgccggtaccggattcaaaggat
tagtgcaccggtcacggcaacataacaacattcttttggaaacaaaaaaaaagaatttcttcgggggagaaatgagagat
attttcttccaccaccgagaattatttgactcttgcatttcaaacaatttacatgatacatcaggccgctcttttatagg
tatagaatttaatgattcttaa
back to top
>NC_016692.1-rpoC2.m124182
atggcagaacgggccaatctggtatttcacaataaagtgatagatggaactgccattaaacggcttattagcagattaat
agatcacttcggaatggcatatacatcacacatcctggatcaagtaaaagctctgggtttccagcaagccactgctacat
ccatttcattaggaattgatgatcttttaacgataccttctaagggatggctagtccaagatgctgaacaacaaagtttg
attttggaaaaacaccatcattttgggaatgtacacgcggtagaaaaattacgccaatcaattgagatatggtatgctac
aagtgaatatttgcgacaagaaatgaatcctaattttaggatgactgacccgtttaacccagtccatataatgtcttttt
caggagctagaggaaatgcatctcaagtgcaccaattagtaggtatgagaggattaatgtcggatccccaaggacaaatg
atcgatttacccattcaaagcaatttacgcgaaggactgtctttaacagaatatatcatttcttgctacggagcccgaaa
aggggttgtggataccgccgtacgaacatcagatgctggatatcttacgcgcagacttgttgaagtagttcaacacattg
ttgtacgtagaacagattgtggcaccacccgagggatttctgtgagtcctcaaaagaggacgcttccggaaagaattttt
atccaaacattaattggtcgtgtattagcggacgatatatatatgggtccgcggtgcattgccattcgaaatcaagatat
tgggcttgggcttgtcgatcgattcagagcctttcgaacacaaccaatatctattcgaactccctttacttgtaggagta
catcttggatttgtcgattatgttatggtcggagccccactcatggtgacctggttgaattgggagaagctgtaggtatt
attgcggggcaatccattggagaaccgggaacgcaactaacattaagaacttttcataccggcggagtatttacaggggg
tactgcagaacatgtccgagccccttttaatggaaaaataaaattcaatgaggatttggttcatcctacacgcacacgtc
acgggcatcctgcttttttatgttatcgggacttgtatgtaattattgagagtgaagatattatacataaggtgactatt
ccaccaaaaagttttcttttagttcaaaacgatcaatatgtagaatcagaacaagtgattgctgagattcgcgcgggaac
atacactttaaatttgaaagagagggttcgaaaacatatttattctgactcagagggggaaatgcactggagtaccgatg
tgtaccattcgcccgaatttacatatagtaatgtccatctcttaccaaaaacaagccatttgtggatattatcagggggt
tcgtacaaattcagtgtagttcctttttcgctccacaaggatcaagatcaaataaacattcattatctttctgccgaacg
aagatatatttctagattctcagtgaataatgatcaagtgagacacaacttatttagttcggatttttcggataaaaaag
aagagaggatttacgattattcagaattgaatcgaataataggtactgggcattgtgatttcatatattctgctattctc
cacgagaatgctgatttattggcaaagagacgaagaaatagatttattattccatttcaattgattcaagaccaagagaa
agaactaatgctacattcccattccggtatctcgatggaaatacccataaatggtattttccgtagaaaaagtattcttg
ctttttttgacgatcctcgatacagaagaaagagttcaggaattactaaatatgggactctaggggcgcattcaatcgtc
aaaagggaggatgtgattgagtatcgaggagtcaaaaaggttaagccaaaataccaaatgaaagtagatcgatttttttt
cattcccgaggaagtgcatattttatccgaatcttcttccataatggtacggaacaatagtatcattggagtagataccc
caatcactttaaatacaagaagccaagtgggcggattggtccgagtggaaagaaaaaaaaaaaggattgaactgaaaatt
ttttcgggtaatatctattttcccggagaaagagataagatatctcgacacagtggcatcttgataccaccaggaacggg
caaaacaaactctaaggaatcaaaaaaattgaaaaaatggatctatgtccaacggatcacacctaccaagaaaaagtatt
ttgttttggttcgacctgtaaccccatatgaaataccggacggtctaaatttagcaacactcttcccccaggatccattt
caggaaaaagataatatgcaacttcgagctgtcaattatatcctttatggaaatggcaaaccgactcggagaatttctga
cacaagtattcaactagttcggacttgtttagtgttgagttgggaccaagacaacaaaagttctttcgccgaagaggtct
gtgcttcctttgttgaagtaaggacaaatggtctgattcgagatttcctaagaatcgacttagtgaaatctcatattttt
tatatcagaaaaagaaatgatccgtcaggttcagaattgatttctgataataggtcagatcgtaccaataaaaatccgtt
ttattccatttattccaacgcaaggattcaacaatcgtttagccaaaatcacggaactattcatacgctcttgaacagaa
ataaggaatcccaatctttgataattttgtcagcatctaattgttttcgcatgggcccattcaacgatgtaaaatatcac
aatgtgataaaacaatcaattaaaaaagatcctctaattccaattaagaatttattgggtcctttaggaacagcccccaa
aattgcgaatttttattcatcattttaccctttaataactcataatcagacctcggtagcgaaatattttgagcttgaca
atttaaaacaggcttttcaagtacttaactattatttaatagctgaaaatgggagaatttataatttcgatccatgccgt
aacatctttttgaatgcagtcaatttgaattggtattttccccatcatcattatcatcataattattgtgaagaaacgtc
cacaataattagtcttgggcagtttatttgtgaaaatgtatgtatagccaaaagcggaccacgcctaaaatcgggtcaag
tttttattgttcaagctgattctatagtaataagatcggctaagccttatttggcgactccgggagcaactgtccatggg
cattatggagaaaccctttacgaaggagatacgttagttacatttatatatgaaaaatcgagatctggtgatataacgca
gggtcttccaaaagtggaacaagtgttagaagtgcgttcgattgattcaatatcgatgaacctagaaaagagaattgagg
gttggaacgaatgtataacaagaattcttggaattccttggggattcgtgattggtgctgagctaactatagtgcaaagt
cgtctctctttggttaataagatccaaaaggtttatcgatctcagggggtacagatccataataggcatatagaaattat
tgtacgtcaaataacatcaaaagtattggtttcagaagatggaatgtctaatgtttttttacccggggaactgattggat
tattgcgagcggaacgaacggggcgtgctttagaagaagcgatttgttatcgagccgttttattgggaataacgagagca
tctctgaacactcaaagttttatatctgaagcaagttttcaagaaactgctcgagttttagcaaaagctgctctccgggg
tcgtatcgattggttgaaaggcctgaaagaaaacgttgtgcttgggggtatgatacccgccggtaccggattcaaaggat
tagtgcaccggtcacggcaacataacaacattcttttggaaacaaaaaaaaagaatttcttcgggggagaaatgagagat
attttcttccaccaccgagaattatttgactcttgcatttcaaacaatttacatgatacatcaggccgctcttttatagg
tatagaatttaatgattcttaa
back to top
>JF317353.1-rpoC24182
atggcagaacgggccaatctggtatttcacaataaagtgatagatggaactgccattaaacggcttattagcagattaat
agatcacttcggaatggcatatacatcacacatcctggatcaagtaaaagctctgggtttccagcaagccactgctacat
ccatttcattaggaattgatgatcttttaacgataccttctaagggatggctagtccaagatgctgaacaacaaagtttg
attttggaaaaacaccatcattttgggaatgtacacgcggtagaaaaattacgccaatcaattgagatatggtatgctac
aagtgaatatttgcgacaagaaatgaatcctaattttaggatgactgacccgtttaacccagtccatataatgtcttttt
caggagctagaggaaatgcatctcaagtgcaccaattagtaggtatgagaggattaatgtcggatccccaaggacaaatg
atcgatttacccattcaaagcaatttacgcgaaggactgtctttaacagaatatatcatttcttgctacggagcccgaaa
aggggttgtggataccgccgtacgaacatcagatgctggatatcttacgcgcagacttgttgaagtagttcaacacattg
ttgtacgtagaacagattgtggcaccacccgagggatttctgtgagtcctcaaaagaggacgcttccagaaagaattttt
atccaaacattaattggtcgtgtattagcggacgatatatatatgggtccgcggtgcattgccattcgaaatcaagatat
tgggcttgggcttgtcgatcgattcagagcctttcgaacacaaccaatatctattcgaactccctttacttgtaggagta
catcttggatttgtcgattatgttatggtcggagccccactcatggtgacctggttgaattgggagaagctgtaggtatt
attgcggggcaatccattggagaaccgggaacgcaactaacattaagaacttttcataccggcggagtatttacaggggg
tactgcagaacatgtacgagccccttttaatggaaaaatcaaattcaatgaggatttggttcatcctacacgcacacgtc
acgggcatcctgcttttttatgttatcaggacttgtatgtaattattgagagcgaagatattatacataaggtgactatt
ccaccaaaaagttttcttttagttcaaaacgatcaatatgtagaatcagaacaagtgattgctgagattcgcgcgggaac
atacactttaaatttgaaagagagggttcgaaaacatatttattctgactcagagggggaaatgcactggagtaccgatg
tgtaccattcgcccgaatttacatatagtaatgtccatctcttaccaaaaacaagccatttgtggatattatcagggggt
tcgtacaaattcagtgtagttcctttttcgctccacaaagatcaagatcaaataaacattcattatctttctgccgaacg
aagatatatttctagattctcagtgaataatgatcaagtgagacacaacttatttagttcggatttttcggataaaaaag
aagataggatttacgattattcagaattgaatcgaataataggtactgggcattgtgatttcatatattctgctattctc
cacgagaatgctgatttattggcaaagagacgaagaaatagatttattattccatttcaattgattcaagaccaagagaa
agaactaatgctgcattcccattccggtatctcgatcgaaatacccataaatggtattttccgtagaaaaagtattcttg
ctttttttgacgatcctcgatacagaagaaagagttcaggaattactaaatatgggactctaggggcgcattcaatcgtc
aaaagggaggatgtgattgagtatcgaggagtcaaaaaggttaagccaaaataccaaatgaaagtagatcgatttttttt
cattcccgaggaagtgcatattttatccgaatcttcttccataatggtacggaacaatagtatcattggagtagataccc
aaatcactttaaatacaagaagccaagtgggcggattggtccgagtggaaagaaaaaaaaaaaggattgaactgaaaatt
ttttcgggtaatatctattttcccggagaaagagataagatatctcgacacagtggcatcttgataccaccaggaacggg
caaaacaaactctaaggaatcaaaaaaattgaaaaattggatctatgtccaacggatcacacctaccaagaaaaagtatt
ttgttttggttcgacctgtaaccccatatgaaataccggacggtctaaatttagcaacactcttcccccaggatccattt
cgggaaaaagataatatgcaacttcgagctgtcaattatatcctttatggaaatggcaaaccgactcggagaatttctga
cacaagtattcaactagttcggacttgtttagtgttgagttgggaccaagacaacaaaagttctttcgccgaagaggtct
gtgcttcctttgttgaagtaaggacaaatggtctgattcgagatttcctaagaatcgacttagtgaaatctcatattttt
tatatcagaaaaagaaatgatccgtcaggttcagaattgatttctgataataggtcagatcgtaccaataaaaatccgtt
ttattccatttattccaacgcaaggattcaacaatcgtttagccaaaatcacggaactattcatacgctcttgaacagaa
ataaggaatcccaatctttgataattttgtcatcatctaattgttttcgcatgggcccattcaacgatgtaaaatatcac
aatgtgataaaacaatcaattaaaaaagatcctctaattccaattaagaatttattgggtcctttaggaacagcccccaa
aattgcgaatttttattcatcattttaccctttaataactcataatcagacctcggtagcgaaatatttggagcttgaca
atttaaaacaggcttttcaagtacttaactattatttaatagctgaaaatgggagaatttataatttcgatccatgccgt
aacatctttttgaatgcagtcaatttgaattggtattttccccatcatcattatcatcataattattgtgaagaaacgtc
cacaataattagtcttgggcagtttatttgtgaaaatgtatgtatagccaaaagcggaccacgcctaaaatcgggtcaag
tttttattgttcaagctgattctatagtaataagatcggctaagccttatttggcgactccgggagcaactgtccatggg
cattatggagaaatcctttacgaaggagatacgttagttacatttatatatgaaaaatcgagatctggtgatataacgca
gggtcttccaaaagtggaacaagtgttagaagtgcgttcgattgattcaatatcgatgaacctagaaaagagaattgagg
gttggaacgaatgtataacaagaattcttggaattccttggggattcgtgattggtgctgagctaactatagtgcaaagt
cgtctctctttggttaataagatccaaaaggtttatcgatctcagggggtacagatccataataggcatatagaaattat
tgtacgtcaaataacatcaaaagtattggtttcagaagatggaatgtctaatgtttttttacccggggaactgattggat
tattgcgagcggaacgaacggggcgtgctttagaagaagcgatttgttatcgagccgttttattgggaataacgagagca
tctctgaacactcaaagttttatatctgaagcaagttttcaagaaactgctcgagttttagcaaaagctgctctccgggg
tcgtatcgattggttgaaaggcctgaaagaaaacgttgtgcttgggggtatgatacccgccggtaccggattcaaaggat
tagtgcaccggtcacggcaacataacaacattcttttggaaacaaaaaaaaagaatttcttcgggggagaaatgagagat
attttcttccaccaccgagaattatttgactcttgcatttcaaacaatttacatgatacatcaggccgctcttttatagg
tatagaatttaatgattcttaa
back to top
>HQ325742.1-rpoC24182
atggcagaacgggccaatctggtatttcacaataaagtgatagatggaactgccattaaacggcttattagcagattaat
agatcacttcggaatggcatatacatcacacatcctggatcaagtaaaagctctgggtttccagcaagccactgctacat
ccatttcattaggaattgatgatcttttaacgataccttctaagggatggctagtccaagatgctgaacaacaaagtttg
attttggaaaaacaccatcattttgggaatgtacacgcggtagaaaaattacgccaatcaattgagatatggtatgctac
aagtgaatatttgcgacaagaaatgaatcctaattttaggatgactgacccgtttaacccagtccatataatgtcttttt
caggagctagaggaaatgcatctcaagtgcaccaattagtaggtatgagaggattaatgtcggatccccaaggacaaatg
atcgatttacccattcaaagcaatttacgcgaaggactgtctttaacagaatatatcatttcttgctacggagcccgaaa
aggggttgtggataccgccgtacgaacatcagatgctggatatcttacgcgcagacttgttgaagtagttcaacacattg
ttgtacgtagaacagattgtggcaccacccgagggatttctgtgagtcctcaaaagaggacgcttccggaaagaattttt
atccaaacattaattggtcgtgtattagcggacgatatatatatgggtccgcggtgcattgccattcgaaatcaagatat
tgggcttgggcttgtcgatcgattcagagcctttcgaacacaaccaatatctattcgaactccctttacttgtaggagta
catcttggatttgtcgattatgttatggtcggagccccactcatggtgacctggttgaattgggagaagctgtaggtatt
attgcggggcaatccattggagaaccgggaacgcaactaacattaagaacttttcataccggcggagtatttacaggggg
tactgcagaacatgtccgagccccttttaatggaaaaataaaattcaatgaggatttggttcatcctacacgcacacgtc
acgggcatcctgcttttttatgttatcgggacttgtatgtaattattgagagtgaagatattatacataaggtgactatt
ccaccaaaaagttttcttttagttcaaaacgatcaatatgtagaatcagaacaagtgattgctgagattcgcgcgggaac
atacactttaaatttgaaagagagggttcgaaaacatatttattctgactcagagggggaaatgcactggagtaccgatg
tgtaccattcgcccgaatttacatatagtaatgtccatctcttaccaaaaacaagccatttgtggatattatcagggggt
tcgtacaaattcagtgtagttcctttttcgctccacaaggatcaagatcaaataaacattcattatctttctgccgaacg
aagatatatttctagattctcagtgaataatgatcaagtgagacacaacttatttagttcggatttttcggataaaaaag
aagagaggatttacgattattcagaattgaatcgaataataggtactgggcattgtgatttcatatattctgctattctc
cacgagaatgctgatttattggcaaagagacgaagaaatagatttattattccatttcaattgattcaagaccaagagaa
agaactaatgctacattcccattccggtatctcgatggaaatacccataaatggtattttccgtagaaaaagtattcttg
ctttttttgacgatcctcgatacagaagaaagagttcaggaattactaaatatgggactctaggggcgcattcaatcgtc
aaaagggaggatgtgattgagtatcgaggagtcaaaaaggttaagccaaaataccaaatgaaagtagatcgatttttttt
cattcccgaggaagtgcatattttatccgaatcttcttccataatggtacggaacaatagtatcattggagtagataccc
caatcactttaaatacaagaagccaagtgggcggattggtccgagtggaaagaaaaaaaaaaaggattgaactgaaaatt
ttttcgggtaatatctattttcccggagaaagagataagatatctcgacacagtggcatcttgataccaccaggaacggg
caaaacaaactctaaggaatcaaaaaaattgaaaaaatggatctatgtccaacggatcacacctaccaagaaaaagtatt
ttgttttggttcgacctgtaaccccatatgaaataccggacggtctaaatttagcaacactcttcccccaggatccattt
caggaaaaagataatatgcaacttcgagctgtcaattatatcctttatggaaatggcaaaccgactcggagaatttctga
cacaagtattcaactagttcggacttgtttagtgttgagttgggaccaagacaacaaaagttctttcgccgaagaggtct
gtgcttcctttgttgaagtaaggacaaatggtctgattcgagatttcctaagaatcgacttagtgaaatctcatattttt
tatatcagaaaaagaaatgatccgtcaggttcagaattgatttctgataataggtcagatcgtaccaataaaaatccgtt
ttattccatttattccaacgcaaggattcaacaatcgtttagccaaaatcacggaactattcatacgctcttgaacagaa
ataaggaatcccaatctttgataattttgtcagcatctaattgttttcgcatgggcccattcaacgatgtaaaatatcac
aatgtgataaaacaatcaattaaaaaagatcctctaattccaattaagaatttattgggtcctttaggaacagcccccaa
aattgcgaatttttattcatcattttaccctttaataactcataatcagacctcggtagcgaaatattttgagcttgaca
atttaaaacaggcttttcaagtacttaactattatttaatagctgaaaatgggagaatttataatttcgatccatgccgt
aacatctttttgaatgcagtcaatttgaattggtattttccccatcatcattatcatcataattattgtgaagaaacgtc
cacaataattagtcttgggcagtttatttgtgaaaatgtatgtatagccaaaagcggaccacgcctaaaatcgggtcaag
tttttattgttcaagctgattctatagtaataagatcggctaagccttatttggcgactccgggagcaactgtccatggg
cattatggagaaaccctttacgaaggagatacgttagttacatttatatatgaaaaatcgagatctggtgatataacgca
gggtcttccaaaagtggaacaagtgttagaagtgcgttcgattgattcaatatcgatgaacctagaaaagagaattgagg
gttggaacgaatgtataacaagaattcttggaattccttggggattcgtgattggtgctgagctaactatagtgcaaagt
cgtctctctttggttaataagatccaaaaggtttatcgatctcagggggtacagatccataataggcatatagaaattat
tgtacgtcaaataacatcaaaagtattggtttcagaagatggaatgtctaatgtttttttacccggggaactgattggat
tattgcgagcggaacgaacggggcgtgctttagaagaagcgatttgttatcgagccgttttattgggaataacgagagca
tctctgaacactcaaagttttatatctgaagcaagttttcaagaaactgctcgagttttagcaaaagctgctctccgggg
tcgtatcgattggttgaaaggcctgaaagaaaacgttgtgcttgggggtatgatacccgccggtaccggattcaaaggat
tagtgcaccggtcacggcaacataacaacattcttttggaaacaaaaaaaaagaatttcttcgggggagaaatgagagat
attttcttccaccaccgagaattatttgactcttgcatttcaaacaatttacatgatacatcaggccgctcttttatagg
tatagaatttaatgattcttaa
back to top
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
rpoC2NC_023215.1-rpoC2Gossypium herbaceumgene
rpoC2NC_016692.1-rpoC2Gossypium herbaceumgene
rpoC2JF317353.1-rpoC2Gossypium herbaceumgene
rpoC2HQ325742.1-rpoC2Gossypium herbaceumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
rpoC2JF317353.1-rpoC2.m12Gossypium herbaceummRNA
rpoC2HQ325742.1-rpoC2.m12Gossypium herbaceummRNA
rpoC2NC_023215.1-rpoC2.m12Gossypium herbaceummRNA
rpoC2NC_016692.1-rpoC2.m12Gossypium herbaceummRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
CottonGen Gene Database2017-09-06