rps2, rps2 (gene) Gossypium herbaceum

Gene Overview
Name rps2
Gene Symbol rps2
Type gene
Organism Gossypium herbaceum
Synonym ribosomal protein S2
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Name Genome Location NCBI Accession
NC_023215.1-rps2 N/A NC_023215.1
NC_016692.1-rps2 N/A NC_016692.1
JF317353.1-rps2.m11 N/A JF317353.1
HQ325742.1-rps2.m11 N/A HQ325742.1
NC_023215.1-rps2.m11 N/A NC_023215.1
NC_016692.1-rps2.m11 N/A NC_016692.1
JF317353.1-rps2 N/A JF317353.1
HQ325742.1-rps2 N/A HQ325742.1

Sequence(s):
>NC_023215.1-rps2711
atggcaagaagatattggaacataaatttggaagagatgttggaagcaggagttcattttggtcatggtactaggaaatg
gaatcctagaatggcgccatatatctccgcaaaacgtaagggtattcatattacaaatctgactagaaccgctcgttttt
tatcagaagcttgtgatttagtttttgatgcagcaagtaagggaaaacaattcttaattgttggtaccaaaaataaagcc
gctgattcggtggcgcgggctgcaataagggctcggtgtcattatgttaataaaaaatggctcggtggtatgttaacaaa
ttggcccactacagaaacgaggcttcataagttcagggacttgagaacagaacaaaagacggggggactcaaccgtcttc
cgaaaagagatgcagctatgttgaagagacaattatctcgcttgcaaacatatctgggcgggattaaatatatgacgaga
ttgcctgatattgtaatcatcgttgatcagcaagaagaatatacggctctgcgagaatgtatcactttgggaattccaac
aatttgtttaatcgatacaaatagcgatcccgatctcgcagatatttcgattccagcaaatgatgacgctatagcttcaa
ttcgattaattcttaacaaattagtagtcgcaatttgtgagggtcgttctagctatatacgaaatccttga
back to top
>NC_016692.1-rps2711
atggcaagaagatattggaacataaatttggaagagatgttggaagcaggagttcattttggtcatggtactaggaaatg
gaatcctagaatggcgccatatatctctgcaaaacgtaagggtattcatattacaaatctgactagaaccgctcgttttt
tatcagaagcttgtgatttagtttttgatgcagcaagtaagggaaaacaattcttaattgttggtaccaaaaataaagcc
gctgattcggtggcgcgggctgcaataagggctcggtgtcattatgttaataaaaaatggctcggtggtatgttaacaaa
ttggcccactacagaaacgaggcttcataagttcagggacttgagaacagaacaaaagacggggggactcaaccgtcttc
cgaaaagagatgcagctatgttgaagagacaattatctcgcttgcaaacatatctgggcgggattaaatatatgacgaga
ttgcctgatattgtaatcatcgttgatcagcaagaagaatatacggctctgcgagaatgtatcactttgggaattccaac
aatttgtttaatcgatacaaatagcgatcccgatctcgcagatatttcgattccagcaaatgatgacgctatagcttcaa
ttcgattaattcttaacaaattagtagtcgcaatttgtgagggtcgttctagctatatacgaaatccttga
back to top
>JF317353.1-rps2.m11711
atggcaagaagatattggaacataaatttggaagagatgttggaagcaggagttcattttggtcatggtactaggaaatg
gaatcctagaatggcgccatatatctccgcaaaacgtaagggtattcatattacaaatctgactagaaccgctcgttttt
tatcagaagcttgtgatttagtttttgatgcagcaagtaagggaaaacaattcttaattgttggtaccaaaaataaagcc
gctgattcggtggcgcgggctgcaataagggctcggtgtcattatgttaataaaaaatggctcggtggtatgttaacaaa
ttggcccactacagaaacgaggcttcataagttcagggacttgagaacagaacaaaagacggggggactcaaccgtcttc
cgaaaagagatgcagctatgttgaagagacaattatctcgcttgcaaacatatctgggcgggattaaatatatgacgaga
ttgcctgatattgtaatcatcgttgatcagcaagaagaatatacggctctgcgagaatgtatcactttgggaattccaac
aatttgtttaatcgatacaaatagcgatcccgatctcgcagatatttcgattccagcaaatgatgacgctatagcttcaa
ttcgattaattcttaacaaattagtagtcgcaatttgtgagggtcgttctagctatatacgaaatccttga
back to top
>HQ325742.1-rps2.m11711
atggcaagaagatattggaacataaatttggaagagatgttggaagcaggagttcattttggtcatggtactaggaaatg
gaatcctagaatggcgccatatatctctgcaaaacgtaagggtattcatattacaaatctgactagaaccgctcgttttt
tatcagaagcttgtgatttagtttttgatgcagcaagtaagggaaaacaattcttaattgttggtaccaaaaataaagcc
gctgattcggtggcgcgggctgcaataagggctcggtgtcattatgttaataaaaaatggctcggtggtatgttaacaaa
ttggcccactacagaaacgaggcttcataagttcagggacttgagaacagaacaaaagacggggggactcaaccgtcttc
cgaaaagagatgcagctatgttgaagagacaattatctcgcttgcaaacatatctgggcgggattaaatatatgacgaga
ttgcctgatattgtaatcatcgttgatcagcaagaagaatatacggctctgcgagaatgtatcactttgggaattccaac
aatttgtttaatcgatacaaatagcgatcccgatctcgcagatatttcgattccagcaaatgatgacgctatagcttcaa
ttcgattaattcttaacaaattagtagtcgcaatttgtgagggtcgttctagctatatacgaaatccttga
back to top
>NC_023215.1-rps2.m11711
atggcaagaagatattggaacataaatttggaagagatgttggaagcaggagttcattttggtcatggtactaggaaatg
gaatcctagaatggcgccatatatctccgcaaaacgtaagggtattcatattacaaatctgactagaaccgctcgttttt
tatcagaagcttgtgatttagtttttgatgcagcaagtaagggaaaacaattcttaattgttggtaccaaaaataaagcc
gctgattcggtggcgcgggctgcaataagggctcggtgtcattatgttaataaaaaatggctcggtggtatgttaacaaa
ttggcccactacagaaacgaggcttcataagttcagggacttgagaacagaacaaaagacggggggactcaaccgtcttc
cgaaaagagatgcagctatgttgaagagacaattatctcgcttgcaaacatatctgggcgggattaaatatatgacgaga
ttgcctgatattgtaatcatcgttgatcagcaagaagaatatacggctctgcgagaatgtatcactttgggaattccaac
aatttgtttaatcgatacaaatagcgatcccgatctcgcagatatttcgattccagcaaatgatgacgctatagcttcaa
ttcgattaattcttaacaaattagtagtcgcaatttgtgagggtcgttctagctatatacgaaatccttga
back to top
>NC_016692.1-rps2.m11711
atggcaagaagatattggaacataaatttggaagagatgttggaagcaggagttcattttggtcatggtactaggaaatg
gaatcctagaatggcgccatatatctctgcaaaacgtaagggtattcatattacaaatctgactagaaccgctcgttttt
tatcagaagcttgtgatttagtttttgatgcagcaagtaagggaaaacaattcttaattgttggtaccaaaaataaagcc
gctgattcggtggcgcgggctgcaataagggctcggtgtcattatgttaataaaaaatggctcggtggtatgttaacaaa
ttggcccactacagaaacgaggcttcataagttcagggacttgagaacagaacaaaagacggggggactcaaccgtcttc
cgaaaagagatgcagctatgttgaagagacaattatctcgcttgcaaacatatctgggcgggattaaatatatgacgaga
ttgcctgatattgtaatcatcgttgatcagcaagaagaatatacggctctgcgagaatgtatcactttgggaattccaac
aatttgtttaatcgatacaaatagcgatcccgatctcgcagatatttcgattccagcaaatgatgacgctatagcttcaa
ttcgattaattcttaacaaattagtagtcgcaatttgtgagggtcgttctagctatatacgaaatccttga
back to top
>JF317353.1-rps2711
atggcaagaagatattggaacataaatttggaagagatgttggaagcaggagttcattttggtcatggtactaggaaatg
gaatcctagaatggcgccatatatctccgcaaaacgtaagggtattcatattacaaatctgactagaaccgctcgttttt
tatcagaagcttgtgatttagtttttgatgcagcaagtaagggaaaacaattcttaattgttggtaccaaaaataaagcc
gctgattcggtggcgcgggctgcaataagggctcggtgtcattatgttaataaaaaatggctcggtggtatgttaacaaa
ttggcccactacagaaacgaggcttcataagttcagggacttgagaacagaacaaaagacggggggactcaaccgtcttc
cgaaaagagatgcagctatgttgaagagacaattatctcgcttgcaaacatatctgggcgggattaaatatatgacgaga
ttgcctgatattgtaatcatcgttgatcagcaagaagaatatacggctctgcgagaatgtatcactttgggaattccaac
aatttgtttaatcgatacaaatagcgatcccgatctcgcagatatttcgattccagcaaatgatgacgctatagcttcaa
ttcgattaattcttaacaaattagtagtcgcaatttgtgagggtcgttctagctatatacgaaatccttga
back to top
>HQ325742.1-rps2711
atggcaagaagatattggaacataaatttggaagagatgttggaagcaggagttcattttggtcatggtactaggaaatg
gaatcctagaatggcgccatatatctctgcaaaacgtaagggtattcatattacaaatctgactagaaccgctcgttttt
tatcagaagcttgtgatttagtttttgatgcagcaagtaagggaaaacaattcttaattgttggtaccaaaaataaagcc
gctgattcggtggcgcgggctgcaataagggctcggtgtcattatgttaataaaaaatggctcggtggtatgttaacaaa
ttggcccactacagaaacgaggcttcataagttcagggacttgagaacagaacaaaagacggggggactcaaccgtcttc
cgaaaagagatgcagctatgttgaagagacaattatctcgcttgcaaacatatctgggcgggattaaatatatgacgaga
ttgcctgatattgtaatcatcgttgatcagcaagaagaatatacggctctgcgagaatgtatcactttgggaattccaac
aatttgtttaatcgatacaaatagcgatcccgatctcgcagatatttcgattccagcaaatgatgacgctatagcttcaa
ttcgattaattcttaacaaattagtagtcgcaatttgtgagggtcgttctagctatatacgaaatccttga
back to top
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
rps2NC_023215.1-rps2Gossypium herbaceumgene
rps2NC_016692.1-rps2Gossypium herbaceumgene
rps2JF317353.1-rps2Gossypium herbaceumgene
rps2HQ325742.1-rps2Gossypium herbaceumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
rps2JF317353.1-rps2.m11Gossypium herbaceummRNA
rps2HQ325742.1-rps2.m11Gossypium herbaceummRNA
rps2NC_023215.1-rps2.m11Gossypium herbaceummRNA
rps2NC_016692.1-rps2.m11Gossypium herbaceummRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
CottonGen Gene Database2017-09-06