atpI, atpI (gene) Gossypium herbaceum

Gene Overview
Name atpI
Gene Symbol atpI
Type gene
Organism Gossypium herbaceum
Synonym ATP synthase CF0 subunit IV
ATP synthase CF0 A subunit
Description NA
Comment ATPase IV subunit; ATP synthase CF0 A chain
Evidence for the gene structure imported from NCBI
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Name Genome Location NCBI Accession
NC_023215.1-atpI N/A NC_023215.1
NC_016692.1-atpI N/A NC_016692.1
JF317353.1-atpI.m10 N/A JF317353.1
HQ325742.1-atpI.m10 N/A HQ325742.1
NC_023215.1-atpI.m10 N/A NC_023215.1
NC_016692.1-atpI.m10 N/A NC_016692.1
JF317353.1-atpI N/A JF317353.1
HQ325742.1-atpI N/A HQ325742.1

Sequence(s):
>NC_023215.1-atpI735
atgaatggtatatcaaacgcactaaacgggttatacgatatctctggtgtggaagtaggccaacatttctattggcaaat
agcaggtttccaagtccatgcccaagtacttattacttcttgggttgtaattgctatcttattaggttccgccgttatcg
ctgttcggaatccacaaaccattccaaccgccggtcaaaatttcttcgaatatgttcttgaattcattcgagacgtaagc
aaaactcagattggagaagaatatggtccatgggttccctttattggaactatgtttctatttatttttgtttctaactg
gtcgggtgctctgttaccttggaaaatcatacaattacctcatggagagttagccgcacctacgaatgatataaatacta
ctgttgctttagctttactcacgtcagtagcatatttctatgcgggtctttcaaaaaaaggattggggtatttcagtaaa
tacattcaacccactccaattcttttacctattaacattttagaggatttcacaaaacccttatcacttagttttcgact
tttcgggaatatattagctgatgaattagtagttgttgttcttgtttctttagtaccttcagtcgtccctatacctgtca
tgttccttggattatttacaagtgggattcaagctcttatttttgcaactttagctgcggcttatataggcgaatccatg
gagggtcatcattga
back to top
>NC_016692.1-atpI735
atgaatggtatatcaaacgcactaaacgggttatacgatatctctggtgtggaagtaggccaacatttctattggcaaat
agcaggtttccaagtccatgcccaagtacttattacctcttgggttgtaattgctatcttattaggttccgccgttatcg
ctgttcggaatccacaaaccattccaaccgccggtcaaaatttcttcgaatatgttcttgaattcattcgagacgtaagc
aaaactcagattggagaagaatatggtccatgggttccctttattggaactatgtttctatttatttttgtttctaactg
gtcgggtgctctgttaccttggaaaatcatacaattacctcatggagagttagccgcacccacgaatgatataaatacta
ctgttgctttagctttactcacgtcagtagcatatttctatgcgggtctttcaaaaaaaggattggggtatttcagtaaa
tacattcaacccactccaattcttttacctattaacattttagaggatttcacaaaacccttatcacttagttttcgact
tttcgggaatatattagctgatgaattagtagttgttgttcttgtttctttagtaccttcagtcgtccctatacctgtca
tgttccttggattatttacaagtgggattcaagctcttatttttgcaactttagctgcggcttatataggcgaatccatg
gagggtcatcattga
back to top
>JF317353.1-atpI.m10735
atgaatggtatatcaaacgcactaaacgggttatacgatatctctggtgtggaagtaggccaacatttctattggcaaat
agcaggtttccaagtccatgcccaagtacttattacttcttgggttgtaattgctatcttattaggttccgccgttatcg
ctgttcggaatccacaaaccattccaaccgccggtcaaaatttcttcgaatatgttcttgaattcattcgagacgtaagc
aaaactcagattggagaagaatatggtccatgggttccctttattggaactatgtttctatttatttttgtttctaactg
gtcgggtgctctgttaccttggaaaatcatacaattacctcatggagagttagccgcacctacgaatgatataaatacta
ctgttgctttagctttactcacgtcagtagcatatttctatgcgggtctttcaaaaaaaggattggggtatttcagtaaa
tacattcaacccactccaattcttttacctattaacattttagaggatttcacaaaacccttatcacttagttttcgact
tttcgggaatatattagctgatgaattagtagttgttgttcttgtttctttagtaccttcagtcgtccctatacctgtca
tgttccttggattatttacaagtgggattcaagctcttatttttgcaactttagctgcggcttatataggcgaatccatg
gagggtcatcattga
back to top
>HQ325742.1-atpI.m10735
atgaatggtatatcaaacgcactaaacgggttatacgatatctctggtgtggaagtaggccaacatttctattggcaaat
agcaggtttccaagtccatgcccaagtacttattacctcttgggttgtaattgctatcttattaggttccgccgttatcg
ctgttcggaatccacaaaccattccaaccgccggtcaaaatttcttcgaatatgttcttgaattcattcgagacgtaagc
aaaactcagattggagaagaatatggtccatgggttccctttattggaactatgtttctatttatttttgtttctaactg
gtcgggtgctctgttaccttggaaaatcatacaattacctcatggagagttagccgcacccacgaatgatataaatacta
ctgttgctttagctttactcacgtcagtagcatatttctatgcgggtctttcaaaaaaaggattggggtatttcagtaaa
tacattcaacccactccaattcttttacctattaacattttagaggatttcacaaaacccttatcacttagttttcgact
tttcgggaatatattagctgatgaattagtagttgttgttcttgtttctttagtaccttcagtcgtccctatacctgtca
tgttccttggattatttacaagtgggattcaagctcttatttttgcaactttagctgcggcttatataggcgaatccatg
gagggtcatcattga
back to top
>NC_023215.1-atpI.m10735
atgaatggtatatcaaacgcactaaacgggttatacgatatctctggtgtggaagtaggccaacatttctattggcaaat
agcaggtttccaagtccatgcccaagtacttattacttcttgggttgtaattgctatcttattaggttccgccgttatcg
ctgttcggaatccacaaaccattccaaccgccggtcaaaatttcttcgaatatgttcttgaattcattcgagacgtaagc
aaaactcagattggagaagaatatggtccatgggttccctttattggaactatgtttctatttatttttgtttctaactg
gtcgggtgctctgttaccttggaaaatcatacaattacctcatggagagttagccgcacctacgaatgatataaatacta
ctgttgctttagctttactcacgtcagtagcatatttctatgcgggtctttcaaaaaaaggattggggtatttcagtaaa
tacattcaacccactccaattcttttacctattaacattttagaggatttcacaaaacccttatcacttagttttcgact
tttcgggaatatattagctgatgaattagtagttgttgttcttgtttctttagtaccttcagtcgtccctatacctgtca
tgttccttggattatttacaagtgggattcaagctcttatttttgcaactttagctgcggcttatataggcgaatccatg
gagggtcatcattga
back to top
>NC_016692.1-atpI.m10735
atgaatggtatatcaaacgcactaaacgggttatacgatatctctggtgtggaagtaggccaacatttctattggcaaat
agcaggtttccaagtccatgcccaagtacttattacctcttgggttgtaattgctatcttattaggttccgccgttatcg
ctgttcggaatccacaaaccattccaaccgccggtcaaaatttcttcgaatatgttcttgaattcattcgagacgtaagc
aaaactcagattggagaagaatatggtccatgggttccctttattggaactatgtttctatttatttttgtttctaactg
gtcgggtgctctgttaccttggaaaatcatacaattacctcatggagagttagccgcacccacgaatgatataaatacta
ctgttgctttagctttactcacgtcagtagcatatttctatgcgggtctttcaaaaaaaggattggggtatttcagtaaa
tacattcaacccactccaattcttttacctattaacattttagaggatttcacaaaacccttatcacttagttttcgact
tttcgggaatatattagctgatgaattagtagttgttgttcttgtttctttagtaccttcagtcgtccctatacctgtca
tgttccttggattatttacaagtgggattcaagctcttatttttgcaactttagctgcggcttatataggcgaatccatg
gagggtcatcattga
back to top
>JF317353.1-atpI735
atgaatggtatatcaaacgcactaaacgggttatacgatatctctggtgtggaagtaggccaacatttctattggcaaat
agcaggtttccaagtccatgcccaagtacttattacttcttgggttgtaattgctatcttattaggttccgccgttatcg
ctgttcggaatccacaaaccattccaaccgccggtcaaaatttcttcgaatatgttcttgaattcattcgagacgtaagc
aaaactcagattggagaagaatatggtccatgggttccctttattggaactatgtttctatttatttttgtttctaactg
gtcgggtgctctgttaccttggaaaatcatacaattacctcatggagagttagccgcacctacgaatgatataaatacta
ctgttgctttagctttactcacgtcagtagcatatttctatgcgggtctttcaaaaaaaggattggggtatttcagtaaa
tacattcaacccactccaattcttttacctattaacattttagaggatttcacaaaacccttatcacttagttttcgact
tttcgggaatatattagctgatgaattagtagttgttgttcttgtttctttagtaccttcagtcgtccctatacctgtca
tgttccttggattatttacaagtgggattcaagctcttatttttgcaactttagctgcggcttatataggcgaatccatg
gagggtcatcattga
back to top
>HQ325742.1-atpI735
atgaatggtatatcaaacgcactaaacgggttatacgatatctctggtgtggaagtaggccaacatttctattggcaaat
agcaggtttccaagtccatgcccaagtacttattacctcttgggttgtaattgctatcttattaggttccgccgttatcg
ctgttcggaatccacaaaccattccaaccgccggtcaaaatttcttcgaatatgttcttgaattcattcgagacgtaagc
aaaactcagattggagaagaatatggtccatgggttccctttattggaactatgtttctatttatttttgtttctaactg
gtcgggtgctctgttaccttggaaaatcatacaattacctcatggagagttagccgcacccacgaatgatataaatacta
ctgttgctttagctttactcacgtcagtagcatatttctatgcgggtctttcaaaaaaaggattggggtatttcagtaaa
tacattcaacccactccaattcttttacctattaacattttagaggatttcacaaaacccttatcacttagttttcgact
tttcgggaatatattagctgatgaattagtagttgttgttcttgtttctttagtaccttcagtcgtccctatacctgtca
tgttccttggattatttacaagtgggattcaagctcttatttttgcaactttagctgcggcttatataggcgaatccatg
gagggtcatcattga
back to top
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
atpINC_023215.1-atpIGossypium herbaceumgene
atpINC_016692.1-atpIGossypium herbaceumgene
atpIJF317353.1-atpIGossypium herbaceumgene
atpIHQ325742.1-atpIGossypium herbaceumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
atpIJF317353.1-atpI.m10Gossypium herbaceummRNA
atpIHQ325742.1-atpI.m10Gossypium herbaceummRNA
atpINC_023215.1-atpI.m10Gossypium herbaceummRNA
atpINC_016692.1-atpI.m10Gossypium herbaceummRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
CottonGen Gene Database2017-09-06