atpH, atpH (gene) Gossypium herbaceum

Gene Overview
Name atpH
Gene Symbol atpH
Type gene
Organism Gossypium herbaceum
Synonym ATP synthase CF0 subunit III
ATP synthase CF0 C subunit
Description NA
Comment ATPase III subunit; ATP synthase CF0 C chain
Evidence for the gene structure imported from NCBI
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Name Genome Location NCBI Accession
NC_023215.1-atpH N/A NC_023215.1
NC_016692.1-atpH N/A NC_016692.1
JF317353.1-atpH.m9 N/A JF317353.1
HQ325742.1-atpH.m9 N/A HQ325742.1
NC_023215.1-atpH.m9 N/A NC_023215.1
NC_016692.1-atpH.m9 N/A NC_016692.1
JF317353.1-atpH N/A JF317353.1
HQ325742.1-atpH N/A HQ325742.1

Sequence(s):
>NC_023215.1-atpH246
atgaatccactgatttctgccgcttccgttattgctgctgggttggctgtcgggcttgcttctattggacctggagttgg
tcaaggtactgctgcgggccaagctgtagaaggtatcgcgagacaacccgaggcagagggaaaaatacgaggtactttat
tgcttagtttggcttttatggaagctttaacaatttatgggctggttgtagcattggcactcttatttgcgaatcccttt
gtttaa
back to top
>NC_016692.1-atpH246
atgaatccactgatttctgccgcttccgttattgctgctgggttggctgtcgggcttgcttctattggacctggagttgg
tcaaggtactgctgcgggccaagctgtagaaggtatcgcgagacaacccgaggcggagggaaaaatacgaggtactttat
tgcttagtttggcttttatggaagctttaacaatttatgggctggttgtagcattggcactcttatttgcgaatcccttt
gtttaa
back to top
>JF317353.1-atpH.m9246
atgaatccactgatttctgccgcttccgttattgctgctgggttggctgtcgggcttgcttctattggacctggagttgg
tcaaggtactgctgcgggccaagctgtagaaggtatcgcgagacaacccgaggcagagggaaaaatacgaggtactttat
tgcttagtttggcttttatggaagctttaacaatttatgggctggttgtagcattggcactcttatttgcgaatcccttt
gtttaa
back to top
>HQ325742.1-atpH.m9246
atgaatccactgatttctgccgcttccgttattgctgctgggttggctgtcgggcttgcttctattggacctggagttgg
tcaaggtactgctgcgggccaagctgtagaaggtatcgcgagacaacccgaggcggagggaaaaatacgaggtactttat
tgcttagtttggcttttatggaagctttaacaatttatgggctggttgtagcattggcactcttatttgcgaatcccttt
gtttaa
back to top
>NC_023215.1-atpH.m9246
atgaatccactgatttctgccgcttccgttattgctgctgggttggctgtcgggcttgcttctattggacctggagttgg
tcaaggtactgctgcgggccaagctgtagaaggtatcgcgagacaacccgaggcagagggaaaaatacgaggtactttat
tgcttagtttggcttttatggaagctttaacaatttatgggctggttgtagcattggcactcttatttgcgaatcccttt
gtttaa
back to top
>NC_016692.1-atpH.m9246
atgaatccactgatttctgccgcttccgttattgctgctgggttggctgtcgggcttgcttctattggacctggagttgg
tcaaggtactgctgcgggccaagctgtagaaggtatcgcgagacaacccgaggcggagggaaaaatacgaggtactttat
tgcttagtttggcttttatggaagctttaacaatttatgggctggttgtagcattggcactcttatttgcgaatcccttt
gtttaa
back to top
>JF317353.1-atpH246
atgaatccactgatttctgccgcttccgttattgctgctgggttggctgtcgggcttgcttctattggacctggagttgg
tcaaggtactgctgcgggccaagctgtagaaggtatcgcgagacaacccgaggcagagggaaaaatacgaggtactttat
tgcttagtttggcttttatggaagctttaacaatttatgggctggttgtagcattggcactcttatttgcgaatcccttt
gtttaa
back to top
>HQ325742.1-atpH246
atgaatccactgatttctgccgcttccgttattgctgctgggttggctgtcgggcttgcttctattggacctggagttgg
tcaaggtactgctgcgggccaagctgtagaaggtatcgcgagacaacccgaggcggagggaaaaatacgaggtactttat
tgcttagtttggcttttatggaagctttaacaatttatgggctggttgtagcattggcactcttatttgcgaatcccttt
gtttaa
back to top
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
atpHNC_023215.1-atpHGossypium herbaceumgene
atpHNC_016692.1-atpHGossypium herbaceumgene
atpHJF317353.1-atpHGossypium herbaceumgene
atpHHQ325742.1-atpHGossypium herbaceumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
atpHJF317353.1-atpH.m9Gossypium herbaceummRNA
atpHHQ325742.1-atpH.m9Gossypium herbaceummRNA
atpHNC_023215.1-atpH.m9Gossypium herbaceummRNA
atpHNC_016692.1-atpH.m9Gossypium herbaceummRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
CottonGen Gene Database2017-09-06