atpF, atpF (gene) Gossypium herbaceum

Gene Overview
Name atpF
Gene Symbol atpF
Type gene
Organism Gossypium herbaceum
Synonym ATP synthase CF0 subunit I
ATP synthase CF0 B subunit
Description NA
Comment ATPase subunit I
Evidence for the gene structure imported from NCBI
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Name Genome Location NCBI Accession
NC_023215.1-atpF N/A NC_023215.1
NC_016692.1-atpF N/A NC_016692.1
JF317353.1-atpF.m8 N/A JF317353.1
HQ325742.1-atpF.m8 N/A HQ325742.1
NC_023215.1-atpF.m8 N/A NC_023215.1
NC_016692.1-atpF.m8 N/A NC_016692.1
JF317353.1-atpF N/A JF317353.1
HQ325742.1-atpF N/A HQ325742.1

Sequence(s):
>NC_023215.1-atpF1361
atgaaaaatgtaaccgattctttcgtttccttgggtcactggccatccgccgggagtttcggggttaataccgatatttt
agcaacaaatccaataaatctaagtgtagtccttggtgtattgatcttttttggaaagggagtgtgtgcgagttgtttat
ttcaagaataggctggattcacccagttgtactttttttcattataactaggaaagaaaagagtgcatgatcccgcgaat
tacttctgaataaatttttaaaatcatattatagaaccatagcatttcgtgattcattggtacatcgactttgattctct
attaaccaataatctgggaccattaacatggttaaggccaaacccgtttgaagttcagatgcagcagggtactctttcta
ctactatgttactaaatacagaaatattttcaaaacaaaaatgttttttcgatataaaacactcatgtcgataaaacgat
ttgagcccctttttccaatgctgaatcgatgacctatgtataaagggggaagaattctttgaatttgaagaaaaaaaaga
aacaactttgctgacaaattacaattatacattatacaattctaagtacaattagaaattccaaattatatgtaaatctt
tgatttattattttttttattatactttttagttttttgatatattttctattttggtcagaagaatcctccgaatattc
tggtcttgtattagtaatcagtttcgatattttggaatatgaatagagacgagagggagagggtaagctcattacattag
aaaaaaaaagatattgggaattaattcccaataaataagaaataattgagcgtgagagccaaatgaatcgaaaggttcat
gtttggttcgggaagggatcatggaatttttgaaataaaaaaaaatgaatggaaagataatctactttcattaagtgatt
tattagataatcgaaaagagaggatcttgaatactattcgaaattcagaagaactacgcgggggggctattgaacggctg
gaaaaggcccgggcccgcttacggaaagtagaaatggaggcggatcagtttcgagtgaatggatactctgagatagaacg
agaaaaattgaatttgattaattcaacttataagattttggaacaattagaaaattacaaaaatgaaaccatttattttg
aacaacaaagagcgattaatcaagtccgacaacgggttttccaacaagctttacaaggagctctaggaactctgaatagt
tctttaaacaacgagttacatttacgcaccattagcgctaatattggcttgtttggggtgatgaaagaaataactgatta
g
back to top
>NC_016692.1-atpF1360
atgaaaaatgtaaccgattctttcgtttccttgggtcactggccatccgccgggagtttcggggttaataccgatatttt
agcaacaaatccaataaatctaagtgtagtccttggtgtattgatcttttttggaaagggagtgtgtgcgagttgtttat
ttcaagaataggctggattcacccagttgtactttttttcattataactaggaaagaaaagagtgcatgatcccgcgaat
tacttctgaataaatttttaaaatcatattatagaaccatagcatttcgtgattcattggtacatcgactttgattctct
attaaccaataatctgggaccattaacatggttaaggccaaacccgtttgaagttcagatgcagcagggtactctttcta
ctactatgttactaaatacagaaatattttcaaaacaaaaatgttttttcgatataaaacactcatgtcgataaaacgat
ttgagcccctttttccaatgctgaatcgatgacctatgtataaagggagaagaattctttgaatttgaagaaaaaaaaga
aacaactttgctgacaaattacaattatacattatacaattctaagtacaattagaaattccaaattatatgtaactttt
ttatttattatttttttattatactttttagttttttgatatattttctattttggtcagaagaatcctccgaatattct
ggtcttggattagtaatcagtttctatattttggaatatgaatagagacgagagggagagggtaagctcattacattaga
aaaaaaagatattgggaattaattcccaataaataagaaataattgagcgtgagagccaaatgaatcgaaaggttcatgt
ttggttcgggaagggatcatggaatttttgaaataaaaaaaaaatgaatggaaagataatctactttcattaagtgattt
attagataatcgaaaagagaggatcttgaatactattcgaaattcagaagaactacgcgggggggctattgaacggctgg
aaaaggcccgggcccgcttacggaaagtagaaatggaggcggatcagtttcgagtgaatggatactctgagatagaacga
gaaaaattgaatttgattaattcaacttataagattttggaacaattagaaaattacaaaaatgaaaccatttattttga
acaacaaagagcgattaatcaagtccgacaacgggttttccaacaagctttacaaggagctctaggaactctgaatagtt
ctttaaacaacgagttacatttacgcaccattagcgctaatattggcttgtttggggtgatgaaagaaataactgattag
back to top
>JF317353.1-atpF.m8570
atgaaaaatgtaaccgattctttcgtttccttgggtcactggccatccgccgggagtttcggggttaataccgatatttt
agcaacaaatccaataaatctaagtgtagtccttggtgtattgatcttttttggaaagggagtgtgtgcgagttgtttat
taagtgatttattagataatcgaaaagagaggatcttgaatactattcgaaattcagaagaactacgcgggggggctatt
gaacggctggaaaaggcccgggcccgcttacggaaagtagaaatggaggcggatcagtttcgagtgaatggatactctga
gatagaacgagaaaaattgaatttgattaattcaacttataagattttggaacaattagaaaattacaaaaatgaaacca
tttattttgaacaacaaagagcgattaatcaagtccgacaacgggttttccaacaagctttacaaggagctctaggaact
ctgaatagttctttaaacaacgagttacatttacgcaccattagcgctaatattggcttgtttggggtgatgaaagaaat
aactgattag
back to top
>HQ325742.1-atpF.m8555
atgaaaaatgtaaccgattctttcgtttccttgggtcactggccatccgccgggagtttcggggttaataccgatatttt
agcaacaaatccaataaatctaagtgtagtccttggtgtattgatcttttttggaaagggagtgttaagtgatttattag
ataatcgaaaagagaggatcttgaatactattcgaaattcagaagaactacgcgggggggctattgaacggctggaaaag
gcccgggcccgcttacggaaagtagaaatggaggcggatcagtttcgagtgaatggatactctgagatagaacgagaaaa
attgaatttgattaattcaacttataagattttggaacaattagaaaattacaaaaatgaaaccatttattttgaacaac
aaagagcgattaatcaagtccgacaacgggttttccaacaagctttacaaggagctctaggaactctgaatagttcttta
aacaacgagttacatttacgcaccattagcgctaatattggcttgtttggggtgatgaaagaaataactgattag
back to top
>NC_023215.1-atpF.m8570
atgaaaaatgtaaccgattctttcgtttccttgggtcactggccatccgccgggagtttcggggttaataccgatatttt
agcaacaaatccaataaatctaagtgtagtccttggtgtattgatcttttttggaaagggagtgtgtgcgagttgtttat
taagtgatttattagataatcgaaaagagaggatcttgaatactattcgaaattcagaagaactacgcgggggggctatt
gaacggctggaaaaggcccgggcccgcttacggaaagtagaaatggaggcggatcagtttcgagtgaatggatactctga
gatagaacgagaaaaattgaatttgattaattcaacttataagattttggaacaattagaaaattacaaaaatgaaacca
tttattttgaacaacaaagagcgattaatcaagtccgacaacgggttttccaacaagctttacaaggagctctaggaact
ctgaatagttctttaaacaacgagttacatttacgcaccattagcgctaatattggcttgtttggggtgatgaaagaaat
aactgattag
back to top
>NC_016692.1-atpF.m8555
atgaaaaatgtaaccgattctttcgtttccttgggtcactggccatccgccgggagtttcggggttaataccgatatttt
agcaacaaatccaataaatctaagtgtagtccttggtgtattgatcttttttggaaagggagtgttaagtgatttattag
ataatcgaaaagagaggatcttgaatactattcgaaattcagaagaactacgcgggggggctattgaacggctggaaaag
gcccgggcccgcttacggaaagtagaaatggaggcggatcagtttcgagtgaatggatactctgagatagaacgagaaaa
attgaatttgattaattcaacttataagattttggaacaattagaaaattacaaaaatgaaaccatttattttgaacaac
aaagagcgattaatcaagtccgacaacgggttttccaacaagctttacaaggagctctaggaactctgaatagttcttta
aacaacgagttacatttacgcaccattagcgctaatattggcttgtttggggtgatgaaagaaataactgattag
back to top
>JF317353.1-atpF1361
atgaaaaatgtaaccgattctttcgtttccttgggtcactggccatccgccgggagtttcggggttaataccgatatttt
agcaacaaatccaataaatctaagtgtagtccttggtgtattgatcttttttggaaagggagtgtgtgcgagttgtttat
ttcaagaataggctggattcacccagttgtactttttttcattataactaggaaagaaaagagtgcatgatcccgcgaat
tacttctgaataaatttttaaaatcatattatagaaccatagcatttcgtgattcattggtacatcgactttgattctct
attaaccaataatctgggaccattaacatggttaaggccaaacccgtttgaagttcagatgcagcagggtactctttcta
ctactatgttactaaatacagaaatattttcaaaacaaaaatgttttttcgatataaaacactcatgtcgataaaacgat
ttgagcccctttttccaatgctgaatcgatgacctatgtataaagggggaagaattctttgaatttgaagaaaaaaaaga
aacaactttgctgacaaattacaattatacattatacaattctaagtacaattagaaattccaaattatatgtaaatctt
tgatttattattttttttattatactttttagttttttgatatattttctattttggtcagaagaatcctccgaatattc
tggtcttgtattagtaatcagtttcgatattttggaatatgaatagagacgagagggagagggtaagctcattacattag
aaaaaaaaagatattgggaattaattcccaataaataagaaataattgagcgtgagagccaaatgaatcgaaaggttcat
gtttggttcgggaagggatcatggaatttttgaaataaaaaaaaatgaatggaaagataatctactttcattaagtgatt
tattagataatcgaaaagagaggatcttgaatactattcgaaattcagaagaactacgcgggggggctattgaacggctg
gaaaaggcccgggcccgcttacggaaagtagaaatggaggcggatcagtttcgagtgaatggatactctgagatagaacg
agaaaaattgaatttgattaattcaacttataagattttggaacaattagaaaattacaaaaatgaaaccatttattttg
aacaacaaagagcgattaatcaagtccgacaacgggttttccaacaagctttacaaggagctctaggaactctgaatagt
tctttaaacaacgagttacatttacgcaccattagcgctaatattggcttgtttggggtgatgaaagaaataactgatta
g
back to top
>HQ325742.1-atpF1360
atgaaaaatgtaaccgattctttcgtttccttgggtcactggccatccgccgggagtttcggggttaataccgatatttt
agcaacaaatccaataaatctaagtgtagtccttggtgtattgatcttttttggaaagggagtgtgtgcgagttgtttat
ttcaagaataggctggattcacccagttgtactttttttcattataactaggaaagaaaagagtgcatgatcccgcgaat
tacttctgaataaatttttaaaatcatattatagaaccatagcatttcgtgattcattggtacatcgactttgattctct
attaaccaataatctgggaccattaacatggttaaggccaaacccgtttgaagttcagatgcagcagggtactctttcta
ctactatgttactaaatacagaaatattttcaaaacaaaaatgttttttcgatataaaacactcatgtcgataaaacgat
ttgagcccctttttccaatgctgaatcgatgacctatgtataaagggagaagaattctttgaatttgaagaaaaaaaaga
aacaactttgctgacaaattacaattatacattatacaattctaagtacaattagaaattccaaattatatgtaactttt
ttatttattatttttttattatactttttagttttttgatatattttctattttggtcagaagaatcctccgaatattct
ggtcttggattagtaatcagtttctatattttggaatatgaatagagacgagagggagagggtaagctcattacattaga
aaaaaaagatattgggaattaattcccaataaataagaaataattgagcgtgagagccaaatgaatcgaaaggttcatgt
ttggttcgggaagggatcatggaatttttgaaataaaaaaaaaatgaatggaaagataatctactttcattaagtgattt
attagataatcgaaaagagaggatcttgaatactattcgaaattcagaagaactacgcgggggggctattgaacggctgg
aaaaggcccgggcccgcttacggaaagtagaaatggaggcggatcagtttcgagtgaatggatactctgagatagaacga
gaaaaattgaatttgattaattcaacttataagattttggaacaattagaaaattacaaaaatgaaaccatttattttga
acaacaaagagcgattaatcaagtccgacaacgggttttccaacaagctttacaaggagctctaggaactctgaatagtt
ctttaaacaacgagttacatttacgcaccattagcgctaatattggcttgtttggggtgatgaaagaaataactgattag
back to top
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
atpFNC_023215.1-atpFGossypium herbaceumgene
atpFNC_016692.1-atpFGossypium herbaceumgene
atpFJF317353.1-atpFGossypium herbaceumgene
atpFHQ325742.1-atpFGossypium herbaceumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
atpFJF317353.1-atpF.m8Gossypium herbaceummRNA
atpFHQ325742.1-atpF.m8Gossypium herbaceummRNA
atpFNC_023215.1-atpF.m8Gossypium herbaceummRNA
atpFNC_016692.1-atpF.m8Gossypium herbaceummRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
CottonGen Gene Database2017-09-06