atpA, atpA (gene) Gossypium herbaceum

Gene Overview
Name atpA
Gene Symbol atpA
Type gene
Organism Gossypium herbaceum
Synonym ATP synthase CF1 alpha subunit
ATP synthase alpha subunit
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Name Genome Location NCBI Accession
NC_023215.1-atpA N/A NC_023215.1
NC_016692.1-atpA N/A NC_016692.1
JF317353.1-atpA.m7 N/A JF317353.1
HQ325742.1-atpA.m7 N/A HQ325742.1
NC_023215.1-atpA.m7 N/A NC_023215.1
NC_016692.1-atpA.m7 N/A NC_016692.1
JF317353.1-atpA N/A JF317353.1
HQ325742.1-atpA N/A HQ325742.1

Sequence(s):
>NC_023215.1-atpA1524
atggtaactattagagccgacgaaattagtaatattatccgtgaacgtattgagcaatataatagagaagtaaagattgt
aaatactggtaccgtccttcaagtgggcgacggcattgctcgtattcatggtcttgatgaagtaatggcaggtgaattag
tagaatttgaagagggtaccataggcattgccctaaatttggaatcaaataatgttggtgttgtattaatgggtgacggt
ttgatgatacaagagggaagttctgtaaaagcaacaggaaaaattgctcagataccagtgagtgaggcttatttgggtcg
tgttataaatgccctggctaagcctattgacggtcggggtgaaatttcagcttctgaatctcggttaattgaatctcctg
ccccaggtattatttcgagacgttccgtttatgagcctcttcaaacaggccttattgctattgattcgatgatccctata
ggacgtggtcagcgagaattaattattggggatagacagaccggtaaaacagcagtagccacggatacgattctcaatca
gcaagggcaaaatgtaatatgtgtttatgtagctatcggtcaaaaagcatcttctgtggctcaggtagtgaccactttcc
aagaaaggggagcgatggagtacaccattgtggtagccgaaacggcggattccccagctacattacaatacctcgctcct
tatacaggagctgctttggctgaatattttatgtatcgtgaacgacacaccttaatcatttatgatgatctttccaagca
agcacaggcttatcgccaaatgtctcttctattacgaagaccgccgggtcgtgaagcttatccaggagatgttttttatt
tgcattcgcgccttttagaaagagccgctaaatcaagttctcagttaggtgaaggaagtatgactgctttaccaatagtt
gagacccagtcgggagacgtttcggcgtatattcctactaatgtgatttccattacagatggacaaatattcttatccgc
cgatctattcaatgctggaatcagacctgctattaatgtggggatttccgtctccagagtaggatcggcggctcaaatta
aagctatgaaacaagtcgctggtaaatcaaaattggaattggcccaattcgccgaattagaagcctttgcacaatttgct
tctgatctcgataaagctactcagaatcaattggcacgaggtcaacgattacgtgagttgcttaaacaatcccaatcagc
tcctcttacggtggcagaacagataagtactatttataccggaacgaatggttatcttgattcattagaaattggacaag
taaggaaatttctcgttgagttacgtacttacttaaaaacgaataaacctcagttccaagaaatcatatcttctaccaag
acattcactgaggaagcggaaacgcttttgaaagacgctattcaggaccaaatggaacgttttcgacttcaggaacaatt
ataa
back to top
>NC_016692.1-atpA1524
atggtaactattagagccgacgaaattagtaatattatccgtgaacgtattgagcaatataatagagaagtaaagattgt
aaatactggtaccgtccttcaagtgggcgacggcattgctcgtattcatggtcttgatgaagtaatggcaggtggattag
tagaatttgaagagggtaccataggcattgccctcaatttggaatcaaataatgttggtgttgtattaatgggtgacggt
ttgatgatacaagagggaagttctgtaaaagcaacaggaaaaattgctcagataccagtgagtgaggcttatttgggtcg
tgttataaatgccctggctaagcctattgacggtcggggtgaaatttcagcttctgaatctcggttaattgaatctcctg
ccccaggtattatttcgagacgttccgtttatgagcctcttcaaacaggacttattgctattgattcgatgatccctata
ggacgtggtcagcgagaattaattattggggatagacagaccggtaaaacagcagtagccacggatacgattctcaatca
gcaagggcaaaatgtaatatgtgtttatgtagctattggtcaaaaagcatcttctgtggctcaggtagtgaccactttcc
aagaaaggggagcgatggagtacaccattgtggtagccgaaacggcggattccccagctacattacaatacctcgctcct
tatacaggagctgctttggctgaatattttatgtatcgtgaacgacacaccttaatcatttatgatgatctttccaagca
agcacaggcttatcgccaaatgtctcttctattacgaagaccgccgggtcgtgaagcttatccaggagatgttttttatt
tgcattcgcgccttttagaaagagccgctaaatcaagttctcagttaggtgaaggaagtatgactgctttaccaatagtt
gagacccagtcgggagacgtttcggcgtatattcctactaatgtgatttccattacagatggacaaatattcttatccgc
cgatctattcaatgctggaatcagacctgctattaatgtggggatttccgtctccagagtaggatcggcggctcaaatta
aagctatgaaacaagtcgctggtaaatcaaaattggaattggcccaattcgccgaattagaagcctttgcacaatttgct
tctgatctcgataaagctactcagaatcaattggcacgaggtcaacgattacgtgagttgcttaaacaatcccaatcagc
tcctcttacggtggcagaacagataagtactatttataccggaacgaatggttatcttgattcattagaaattggacaag
taaggaaatttctcgttgagttacgtacttacttaaaaacgaataaacctcagttccaagaaatcatatcttctaccaag
acattcactgaggaagcggaaacgcttttgaaagacgctattcaggaccaaatggaacgttttcgacttcaggaacaatt
ataa
back to top
>JF317353.1-atpA.m71524
atggtaactattagagccgacgaaattagtaatattatccgtgaacgtattgagcaatataatagagaagtaaagattgt
aaatactggtaccgtccttcaagtgggcgacggcattgctcgtattcatggtcttgatgaagtaatggcaggtgaattag
tagaatttgaagagggtaccataggcattgccctaaatttggaatcaaataatgttggtgttgtattaatgggtgacggt
ttgatgatacaagagggaagttctgtaaaagcaacaggaaaaattgctcagataccagtgagtgaggcttatttgggtcg
tgttataaatgccctggctaagcctattgacggtcggggtgaaatttcagcttctgaatctcggttaattgaatctcctg
ccccaggtattatttcgagacgttccgtttatgagcctcttcaaacaggccttattgctattgattcgatgatccctata
ggacgtggtcagcgagaattaattattggggatagacagaccggtaaaacagcagtagccacggatacgattctcaatca
gcaagggcaaaatgtaatatgtgtttatgtagctatcggtcaaaaagcatcttctgtggctcaggtagtgaccactttcc
aagaaaggggagcgatggagtacaccattgtggtagccgaaacggcggattccccagctacattacaatacctcgctcct
tatacaggagctgctttggctgaatattttatgtatcgtgaacgacacaccttaatcatttatgatgatctttccaagca
agcacaggcttatcgccaaatgtctcttctattacgaagaccgccgggtcgtgaagcttatccaggagatgttttttatt
tgcattcgcgccttttagaaagagccgctaaatcaagttctcagttaggtgaaggaagtatgactgctttaccaatagtt
gagacccagtcgggagacgtttcggcgtatattcctactaatgtgatttccattacagatggacaaatattcttatccgc
cgatctattcaatgctggaatcagacctgctattaatgtggggatttccgtctccagagtaggatcggcggctcaaatta
aagctatgaaacaagtcgctggtaaatcaaaattggaattggcccaattcgccgaattagaagcctttgcacaatttgct
tctgatctcgataaagctactcagaatcaattggcacgaggtcaacgattacgtgagttgcttaaacaatcccaatcagc
tcctcttacggtggcagaacagataagtactatttataccggaacgaatggttatcttgattcattagaaattggacaag
taaggaaatttctcgttgagttacgtacttacttaaaaacgaataaacctcagttccaagaaatcatatcttctaccaag
acattcactgaggaagcggaaacgcttttgaaagacgctattcaggaccaaatggaacgttttcgacttcaggaacaatt
ataa
back to top
>HQ325742.1-atpA.m71524
atggtaactattagagccgacgaaattagtaatattatccgtgaacgtattgagcaatataatagagaagtaaagattgt
aaatactggtaccgtccttcaagtgggcgacggcattgctcgtattcatggtcttgatgaagtaatggcaggtggattag
tagaatttgaagagggtaccataggcattgccctcaatttggaatcaaataatgttggtgttgtattaatgggtgacggt
ttgatgatacaagagggaagttctgtaaaagcaacaggaaaaattgctcagataccagtgagtgaggcttatttgggtcg
tgttataaatgccctggctaagcctattgacggtcggggtgaaatttcagcttctgaatctcggttaattgaatctcctg
ccccaggtattatttcgagacgttccgtttatgagcctcttcaaacaggacttattgctattgattcgatgatccctata
ggacgtggtcagcgagaattaattattggggatagacagaccggtaaaacagcagtagccacggatacgattctcaatca
gcaagggcaaaatgtaatatgtgtttatgtagctattggtcaaaaagcatcttctgtggctcaggtagtgaccactttcc
aagaaaggggagcgatggagtacaccattgtggtagccgaaacggcggattccccagctacattacaatacctcgctcct
tatacaggagctgctttggctgaatattttatgtatcgtgaacgacacaccttaatcatttatgatgatctttccaagca
agcacaggcttatcgccaaatgtctcttctattacgaagaccgccgggtcgtgaagcttatccaggagatgttttttatt
tgcattcgcgccttttagaaagagccgctaaatcaagttctcagttaggtgaaggaagtatgactgctttaccaatagtt
gagacccagtcgggagacgtttcggcgtatattcctactaatgtgatttccattacagatggacaaatattcttatccgc
cgatctattcaatgctggaatcagacctgctattaatgtggggatttccgtctccagagtaggatcggcggctcaaatta
aagctatgaaacaagtcgctggtaaatcaaaattggaattggcccaattcgccgaattagaagcctttgcacaatttgct
tctgatctcgataaagctactcagaatcaattggcacgaggtcaacgattacgtgagttgcttaaacaatcccaatcagc
tcctcttacggtggcagaacagataagtactatttataccggaacgaatggttatcttgattcattagaaattggacaag
taaggaaatttctcgttgagttacgtacttacttaaaaacgaataaacctcagttccaagaaatcatatcttctaccaag
acattcactgaggaagcggaaacgcttttgaaagacgctattcaggaccaaatggaacgttttcgacttcaggaacaatt
ataa
back to top
>NC_023215.1-atpA.m71524
atggtaactattagagccgacgaaattagtaatattatccgtgaacgtattgagcaatataatagagaagtaaagattgt
aaatactggtaccgtccttcaagtgggcgacggcattgctcgtattcatggtcttgatgaagtaatggcaggtgaattag
tagaatttgaagagggtaccataggcattgccctaaatttggaatcaaataatgttggtgttgtattaatgggtgacggt
ttgatgatacaagagggaagttctgtaaaagcaacaggaaaaattgctcagataccagtgagtgaggcttatttgggtcg
tgttataaatgccctggctaagcctattgacggtcggggtgaaatttcagcttctgaatctcggttaattgaatctcctg
ccccaggtattatttcgagacgttccgtttatgagcctcttcaaacaggccttattgctattgattcgatgatccctata
ggacgtggtcagcgagaattaattattggggatagacagaccggtaaaacagcagtagccacggatacgattctcaatca
gcaagggcaaaatgtaatatgtgtttatgtagctatcggtcaaaaagcatcttctgtggctcaggtagtgaccactttcc
aagaaaggggagcgatggagtacaccattgtggtagccgaaacggcggattccccagctacattacaatacctcgctcct
tatacaggagctgctttggctgaatattttatgtatcgtgaacgacacaccttaatcatttatgatgatctttccaagca
agcacaggcttatcgccaaatgtctcttctattacgaagaccgccgggtcgtgaagcttatccaggagatgttttttatt
tgcattcgcgccttttagaaagagccgctaaatcaagttctcagttaggtgaaggaagtatgactgctttaccaatagtt
gagacccagtcgggagacgtttcggcgtatattcctactaatgtgatttccattacagatggacaaatattcttatccgc
cgatctattcaatgctggaatcagacctgctattaatgtggggatttccgtctccagagtaggatcggcggctcaaatta
aagctatgaaacaagtcgctggtaaatcaaaattggaattggcccaattcgccgaattagaagcctttgcacaatttgct
tctgatctcgataaagctactcagaatcaattggcacgaggtcaacgattacgtgagttgcttaaacaatcccaatcagc
tcctcttacggtggcagaacagataagtactatttataccggaacgaatggttatcttgattcattagaaattggacaag
taaggaaatttctcgttgagttacgtacttacttaaaaacgaataaacctcagttccaagaaatcatatcttctaccaag
acattcactgaggaagcggaaacgcttttgaaagacgctattcaggaccaaatggaacgttttcgacttcaggaacaatt
ataa
back to top
>NC_016692.1-atpA.m71524
atggtaactattagagccgacgaaattagtaatattatccgtgaacgtattgagcaatataatagagaagtaaagattgt
aaatactggtaccgtccttcaagtgggcgacggcattgctcgtattcatggtcttgatgaagtaatggcaggtggattag
tagaatttgaagagggtaccataggcattgccctcaatttggaatcaaataatgttggtgttgtattaatgggtgacggt
ttgatgatacaagagggaagttctgtaaaagcaacaggaaaaattgctcagataccagtgagtgaggcttatttgggtcg
tgttataaatgccctggctaagcctattgacggtcggggtgaaatttcagcttctgaatctcggttaattgaatctcctg
ccccaggtattatttcgagacgttccgtttatgagcctcttcaaacaggacttattgctattgattcgatgatccctata
ggacgtggtcagcgagaattaattattggggatagacagaccggtaaaacagcagtagccacggatacgattctcaatca
gcaagggcaaaatgtaatatgtgtttatgtagctattggtcaaaaagcatcttctgtggctcaggtagtgaccactttcc
aagaaaggggagcgatggagtacaccattgtggtagccgaaacggcggattccccagctacattacaatacctcgctcct
tatacaggagctgctttggctgaatattttatgtatcgtgaacgacacaccttaatcatttatgatgatctttccaagca
agcacaggcttatcgccaaatgtctcttctattacgaagaccgccgggtcgtgaagcttatccaggagatgttttttatt
tgcattcgcgccttttagaaagagccgctaaatcaagttctcagttaggtgaaggaagtatgactgctttaccaatagtt
gagacccagtcgggagacgtttcggcgtatattcctactaatgtgatttccattacagatggacaaatattcttatccgc
cgatctattcaatgctggaatcagacctgctattaatgtggggatttccgtctccagagtaggatcggcggctcaaatta
aagctatgaaacaagtcgctggtaaatcaaaattggaattggcccaattcgccgaattagaagcctttgcacaatttgct
tctgatctcgataaagctactcagaatcaattggcacgaggtcaacgattacgtgagttgcttaaacaatcccaatcagc
tcctcttacggtggcagaacagataagtactatttataccggaacgaatggttatcttgattcattagaaattggacaag
taaggaaatttctcgttgagttacgtacttacttaaaaacgaataaacctcagttccaagaaatcatatcttctaccaag
acattcactgaggaagcggaaacgcttttgaaagacgctattcaggaccaaatggaacgttttcgacttcaggaacaatt
ataa
back to top
>JF317353.1-atpA1524
atggtaactattagagccgacgaaattagtaatattatccgtgaacgtattgagcaatataatagagaagtaaagattgt
aaatactggtaccgtccttcaagtgggcgacggcattgctcgtattcatggtcttgatgaagtaatggcaggtgaattag
tagaatttgaagagggtaccataggcattgccctaaatttggaatcaaataatgttggtgttgtattaatgggtgacggt
ttgatgatacaagagggaagttctgtaaaagcaacaggaaaaattgctcagataccagtgagtgaggcttatttgggtcg
tgttataaatgccctggctaagcctattgacggtcggggtgaaatttcagcttctgaatctcggttaattgaatctcctg
ccccaggtattatttcgagacgttccgtttatgagcctcttcaaacaggccttattgctattgattcgatgatccctata
ggacgtggtcagcgagaattaattattggggatagacagaccggtaaaacagcagtagccacggatacgattctcaatca
gcaagggcaaaatgtaatatgtgtttatgtagctatcggtcaaaaagcatcttctgtggctcaggtagtgaccactttcc
aagaaaggggagcgatggagtacaccattgtggtagccgaaacggcggattccccagctacattacaatacctcgctcct
tatacaggagctgctttggctgaatattttatgtatcgtgaacgacacaccttaatcatttatgatgatctttccaagca
agcacaggcttatcgccaaatgtctcttctattacgaagaccgccgggtcgtgaagcttatccaggagatgttttttatt
tgcattcgcgccttttagaaagagccgctaaatcaagttctcagttaggtgaaggaagtatgactgctttaccaatagtt
gagacccagtcgggagacgtttcggcgtatattcctactaatgtgatttccattacagatggacaaatattcttatccgc
cgatctattcaatgctggaatcagacctgctattaatgtggggatttccgtctccagagtaggatcggcggctcaaatta
aagctatgaaacaagtcgctggtaaatcaaaattggaattggcccaattcgccgaattagaagcctttgcacaatttgct
tctgatctcgataaagctactcagaatcaattggcacgaggtcaacgattacgtgagttgcttaaacaatcccaatcagc
tcctcttacggtggcagaacagataagtactatttataccggaacgaatggttatcttgattcattagaaattggacaag
taaggaaatttctcgttgagttacgtacttacttaaaaacgaataaacctcagttccaagaaatcatatcttctaccaag
acattcactgaggaagcggaaacgcttttgaaagacgctattcaggaccaaatggaacgttttcgacttcaggaacaatt
ataa
back to top
>HQ325742.1-atpA1524
atggtaactattagagccgacgaaattagtaatattatccgtgaacgtattgagcaatataatagagaagtaaagattgt
aaatactggtaccgtccttcaagtgggcgacggcattgctcgtattcatggtcttgatgaagtaatggcaggtggattag
tagaatttgaagagggtaccataggcattgccctcaatttggaatcaaataatgttggtgttgtattaatgggtgacggt
ttgatgatacaagagggaagttctgtaaaagcaacaggaaaaattgctcagataccagtgagtgaggcttatttgggtcg
tgttataaatgccctggctaagcctattgacggtcggggtgaaatttcagcttctgaatctcggttaattgaatctcctg
ccccaggtattatttcgagacgttccgtttatgagcctcttcaaacaggacttattgctattgattcgatgatccctata
ggacgtggtcagcgagaattaattattggggatagacagaccggtaaaacagcagtagccacggatacgattctcaatca
gcaagggcaaaatgtaatatgtgtttatgtagctattggtcaaaaagcatcttctgtggctcaggtagtgaccactttcc
aagaaaggggagcgatggagtacaccattgtggtagccgaaacggcggattccccagctacattacaatacctcgctcct
tatacaggagctgctttggctgaatattttatgtatcgtgaacgacacaccttaatcatttatgatgatctttccaagca
agcacaggcttatcgccaaatgtctcttctattacgaagaccgccgggtcgtgaagcttatccaggagatgttttttatt
tgcattcgcgccttttagaaagagccgctaaatcaagttctcagttaggtgaaggaagtatgactgctttaccaatagtt
gagacccagtcgggagacgtttcggcgtatattcctactaatgtgatttccattacagatggacaaatattcttatccgc
cgatctattcaatgctggaatcagacctgctattaatgtggggatttccgtctccagagtaggatcggcggctcaaatta
aagctatgaaacaagtcgctggtaaatcaaaattggaattggcccaattcgccgaattagaagcctttgcacaatttgct
tctgatctcgataaagctactcagaatcaattggcacgaggtcaacgattacgtgagttgcttaaacaatcccaatcagc
tcctcttacggtggcagaacagataagtactatttataccggaacgaatggttatcttgattcattagaaattggacaag
taaggaaatttctcgttgagttacgtacttacttaaaaacgaataaacctcagttccaagaaatcatatcttctaccaag
acattcactgaggaagcggaaacgcttttgaaagacgctattcaggaccaaatggaacgttttcgacttcaggaacaatt
ataa
back to top
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
atpANC_023215.1-atpAGossypium herbaceumgene
atpANC_016692.1-atpAGossypium herbaceumgene
atpAJF317353.1-atpAGossypium herbaceumgene
atpAHQ325742.1-atpAGossypium herbaceumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
atpAJF317353.1-atpA.m7Gossypium herbaceummRNA
atpAHQ325742.1-atpA.m7Gossypium herbaceummRNA
atpANC_023215.1-atpA.m7Gossypium herbaceummRNA
atpANC_016692.1-atpA.m7Gossypium herbaceummRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
CottonGen Gene Database2017-09-06