trnG-UCC, trnG-UCC (gene) Gossypium herbaceum

Gene Overview
Name trnG-UCC
Gene Symbol trnG-UCC
Type gene
Organism Gossypium herbaceum
Synonym NA
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Name Genome Location NCBI Accession
NC_023215.1-trnG-UCC N/A NC_023215.1
JF317353.1-trnG-UCC N/A JF317353.1

Sequence(s):
>NC_023215.1-trnG-UCC848
gcgggtatagtttagtggtaaaagtgtgattcgttctattaatccccctaagagttaaggggtccctcggtttgattcat
attccgagcaaaaactttatttcttaaaaggatttaatcctttacctctcaacgaaagatttgaggaagaatatacattc
tcgtgatttggatccaagggccaattaaattagatataattttttaattatattctaactaaaaattgaaaaattggatt
atgaaattacgaaacataaatttttttttttcaattggatcaatacttccaattgaataagtatgaggaaaagatccatg
gataaagatagaaaagtgtatttctaatcgtaactaaatcttcaattttttttgatgggatagattgaagcaaaatagct
attaaacgataactttggtttactagagacatttacatcttgttttagctcggcggaaacaaaatgcttttcctaaggat
tttctcaaatagaaatagagaacgaagtaactagaaaaattgttctattctaatcccactcttctagaaggatcatctag
aaagcgaattgttttgaatgcattcagacagaaaagctaacatagatggtatgggccgaattcttatttcatttcgttcc
tgccttatctttatcttatttatattcaatttttttgatttcttttttttttatttatccatcttccataaaggagccga
atgaaaccaaaatttcatgttcggttttgaattagagacgctaaaaataatgaatcaacgtcgactataacccctagcct
tccaagctaacgatgcgggttcgattcccgctacccgctcgatattcg
back to top
>JF317353.1-trnG-UCC848
gcgggtatagtttagtggtaaaagtgtgattcgttctattaatccccctaagagttaaggggtccctcggtttgattcat
attccgagcaaaaactttatttcttaaaaggatttaatcctttacctctcaacgaaagatttgaggaagaatatacattc
tcgtgatttggatccaagggccaattaaattagatataattttttaattatattctaactaaaaattgaaaaattggatt
atgaaattacgaaacataaatttttttttttcaattggatcaatacttccaattgaataagtatgaggaaaagatccatg
gataaagatagaaaagtgtatttctaatcgtaactaaatcttcaattttttttgatgggatagattgaagcaaaatagct
attaaacgataactttggtttactagagacatttacatcttgttttagctcggcggaaacaaaatgcttttcctaaggat
tttctcaaatagaaatagagaacgaagtaactagaaaaattgttctattctaatcccactcttctagaaggatcatctag
aaagcgaattgttttgaatgcattcagacagaaaagctaacatagatggtatgggccgaattcttatttcatttcgttcc
tgccttatctttatcttatttatattcaatttttttgatttcttttttttttatttatccatcttccataaaggagccga
atgaaaccaaaatttcatgttcggttttgaattagagacgctaaaaataatgaatcaacgtcgactataacccctagcct
tccaagctaacgatgcgggttcgattcccgctacccgctcgatattcg
back to top
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
trnG-UCCNC_023215.1-trnG-UCCGossypium herbaceumgene
trnG-UCCJF317353.1-trnG-UCCGossypium herbaceumgene


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
CottonGen Gene Database2017-09-06