psbI, psbI (gene) Gossypium herbaceum

Gene Overview
Name psbI
Gene Symbol psbI
Type gene
Organism Gossypium herbaceum
Synonym photosystem II protein I
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Name Genome Location NCBI Accession
NC_023215.1-psbI N/A NC_023215.1
NC_016692.1-psbI N/A NC_016692.1
JF317353.1-psbI.m6 N/A JF317353.1
HQ325742.1-psbI.m6 N/A HQ325742.1
NC_023215.1-psbI.m6 N/A NC_023215.1
NC_016692.1-psbI.m6 N/A NC_016692.1
JF317353.1-psbI N/A JF317353.1
HQ325742.1-psbI N/A HQ325742.1

Sequence(s):
>NC_023215.1-psbI111
atgcttactcttaaactctttgtttacaccgtagtaatattctttgtttctctcttcatcttcggatttctatctaatga
tccgggacgtaatcctggacgcgaagaataa
back to top
>NC_016692.1-psbI111
atgcttactcttaaactctttgtttacaccgtagtaatattctttgtttctctcttcatcttcggattcctatctaatga
tccgggacgtaatcctggacgcgaagaataa
back to top
>JF317353.1-psbI.m6111
atgcttactcttaaactctttgtttacaccgtagtaatattctttgtttctctcttcatcttcggatttctatctaatga
tccgggacgtaatcctggacgcgaagaataa
back to top
>HQ325742.1-psbI.m6111
atgcttactcttaaactctttgtttacaccgtagtaatattctttgtttctctcttcatcttcggattcctatctaatga
tccgggacgtaatcctggacgcgaagaataa
back to top
>NC_023215.1-psbI.m6111
atgcttactcttaaactctttgtttacaccgtagtaatattctttgtttctctcttcatcttcggatttctatctaatga
tccgggacgtaatcctggacgcgaagaataa
back to top
>NC_016692.1-psbI.m6111
atgcttactcttaaactctttgtttacaccgtagtaatattctttgtttctctcttcatcttcggattcctatctaatga
tccgggacgtaatcctggacgcgaagaataa
back to top
>JF317353.1-psbI111
atgcttactcttaaactctttgtttacaccgtagtaatattctttgtttctctcttcatcttcggatttctatctaatga
tccgggacgtaatcctggacgcgaagaataa
back to top
>HQ325742.1-psbI111
atgcttactcttaaactctttgtttacaccgtagtaatattctttgtttctctcttcatcttcggattcctatctaatga
tccgggacgtaatcctggacgcgaagaataa
back to top
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
psbINC_023215.1-psbIGossypium herbaceumgene
psbINC_016692.1-psbIGossypium herbaceumgene
psbIJF317353.1-psbIGossypium herbaceumgene
psbIHQ325742.1-psbIGossypium herbaceumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
psbIJF317353.1-psbI.m6Gossypium herbaceummRNA
psbIHQ325742.1-psbI.m6Gossypium herbaceummRNA
psbINC_023215.1-psbI.m6Gossypium herbaceummRNA
psbINC_016692.1-psbI.m6Gossypium herbaceummRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
CottonGen Gene Database2017-09-06