psbK, psbK (gene) Gossypium herbaceum

Gene Overview
Name psbK
Gene Symbol psbK
Type gene
Organism Gossypium herbaceum
Synonym photosystem II protein K
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Name Genome Location NCBI Accession
NC_023215.1-psbK N/A NC_023215.1
NC_016692.1-psbK N/A NC_016692.1
JF317353.1-psbK.m5 N/A JF317353.1
HQ325742.1-psbK.m5 N/A HQ325742.1
NC_023215.1-psbK.m5 N/A NC_023215.1
NC_016692.1-psbK.m5 N/A NC_016692.1
JF317353.1-psbK N/A JF317353.1
HQ325742.1-psbK N/A HQ325742.1

Sequence(s):
>NC_023215.1-psbK186
atgcttaatatctttaatttgatctgtatctgttttaattctgcccttttttcgagtagttttttattcgccaaattgcc
cgaggcctatgcttttttgaatccaatcgtagattttatgccagtaatacctgttctctttttgctcttagcctttgttt
ggcaagctgctgtaagttttcgatga
back to top
>NC_016692.1-psbK186
atgcttaatatctttaatttgatctgtatctgttttaattctgcccttttttcgagtagttttttattcgccaaattgcc
cgaggcctatgcttttttgaatccaatcgtagattttatgccagtaatacctgttctcttttttctcttagcctttgttt
ggcaagctgctgtaagttttcgatga
back to top
>JF317353.1-psbK.m5186
atgcttaatatctttaatttgatctgtatctgttttaattctgcccttttttcgagtagttttttattcgccaaattgcc
cgaggcctatgcttttttgaatccaatcgtagattttatgccagtaatacctgttctctttttgctcttagcctttgttt
ggcaagctgctgtaagttttcgatga
back to top
>HQ325742.1-psbK.m5186
atgcttaatatctttaatttgatctgtatctgttttaattctgcccttttttcgagtagttttttattcgccaaattgcc
cgaggcctatgcttttttgaatccaatcgtagattttatgccagtaatacctgttctcttttttctcttagcctttgttt
ggcaagctgctgtaagttttcgatga
back to top
>NC_023215.1-psbK.m5186
atgcttaatatctttaatttgatctgtatctgttttaattctgcccttttttcgagtagttttttattcgccaaattgcc
cgaggcctatgcttttttgaatccaatcgtagattttatgccagtaatacctgttctctttttgctcttagcctttgttt
ggcaagctgctgtaagttttcgatga
back to top
>NC_016692.1-psbK.m5186
atgcttaatatctttaatttgatctgtatctgttttaattctgcccttttttcgagtagttttttattcgccaaattgcc
cgaggcctatgcttttttgaatccaatcgtagattttatgccagtaatacctgttctcttttttctcttagcctttgttt
ggcaagctgctgtaagttttcgatga
back to top
>JF317353.1-psbK186
atgcttaatatctttaatttgatctgtatctgttttaattctgcccttttttcgagtagttttttattcgccaaattgcc
cgaggcctatgcttttttgaatccaatcgtagattttatgccagtaatacctgttctctttttgctcttagcctttgttt
ggcaagctgctgtaagttttcgatga
back to top
>HQ325742.1-psbK186
atgcttaatatctttaatttgatctgtatctgttttaattctgcccttttttcgagtagttttttattcgccaaattgcc
cgaggcctatgcttttttgaatccaatcgtagattttatgccagtaatacctgttctcttttttctcttagcctttgttt
ggcaagctgctgtaagttttcgatga
back to top
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
psbKNC_023215.1-psbKGossypium herbaceumgene
psbKNC_016692.1-psbKGossypium herbaceumgene
psbKJF317353.1-psbKGossypium herbaceumgene
psbKHQ325742.1-psbKGossypium herbaceumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
psbKJF317353.1-psbK.m5Gossypium herbaceummRNA
psbKHQ325742.1-psbK.m5Gossypium herbaceummRNA
psbKNC_023215.1-psbK.m5Gossypium herbaceummRNA
psbKNC_016692.1-psbK.m5Gossypium herbaceummRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
CottonGen Gene Database2017-09-06