matK, matK (gene) Gossypium herbaceum

Gene Overview
Name matK
Gene Symbol matK
Type gene
Organism Gossypium herbaceum
Synonym maturase K
maturase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Name Genome Location NCBI Accession
NC_023215.1-matK N/A NC_023215.1
JX517350.1-matK N/A JX517350.1
JN201400.1-matK N/A JN201400.1
JN201399.1-matK N/A JN201399.1
JN201398.1-matK N/A JN201398.1
JN201397.1-matK N/A JN201397.1
JN201396.1-matK N/A JN201396.1
JN201395.1-matK N/A JN201395.1
JN201394.1-matK N/A JN201394.1
JN201393.1-matK N/A JN201393.1
JN201392.1-matK N/A JN201392.1
JN201391.1-matK N/A JN201391.1
NC_016692.1-matK N/A NC_016692.1
JF270794.1-matK N/A JF270794.1
JF317353.1-matK.m3 N/A JF317353.1
GU935202.1-matK.m1 N/A GU935202.1
GU935201.1-matK.m1 N/A GU935201.1
GU935200.1-matK.m1 N/A GU935200.1
GU935199.1-matK.m1 N/A GU935199.1
GU935198.1-matK.m1 N/A GU935198.1
GU935197.1-matK.m1 N/A GU935197.1
GU935196.1-matK.m1 N/A GU935196.1
GU935195.1-matK.m1 N/A GU935195.1
GU935194.1-matK.m1 N/A GU935194.1
GU935193.1-matK.m1 N/A GU935193.1
GU935192.1-matK.m1 N/A GU935192.1
GU935191.1-matK.m1 N/A GU935191.1
GU935190.1-matK.m1 N/A GU935190.1
AF403556.1-matK.m1 N/A AF403556.1
HQ325742.1-matK.m3 N/A HQ325742.1
NC_023215.1-matK.m3 N/A NC_023215.1
JX517350.1-matK.m1 N/A JX517350.1
JN201400.1-matK.m1 N/A JN201400.1
JN201399.1-matK.m1 N/A JN201399.1
JN201398.1-matK.m1 N/A JN201398.1
JN201397.1-matK.m1 N/A JN201397.1
JN201396.1-matK.m1 N/A JN201396.1
JN201395.1-matK.m1 N/A JN201395.1
JN201394.1-matK.m1 N/A JN201394.1
JN201393.1-matK.m1 N/A JN201393.1
JN201392.1-matK.m1 N/A JN201392.1
JN201391.1-matK.m1 N/A JN201391.1
NC_016692.1-matK.m3 N/A NC_016692.1
JF270794.1-matK.m1 N/A JF270794.1
JF317353.1-matK N/A JF317353.1
GU935202.1-matK N/A GU935202.1
GU935201.1-matK N/A GU935201.1
GU935200.1-matK N/A GU935200.1
GU935199.1-matK N/A GU935199.1
GU935198.1-matK N/A GU935198.1
GU935197.1-matK N/A GU935197.1
GU935196.1-matK N/A GU935196.1
GU935195.1-matK N/A GU935195.1
GU935194.1-matK N/A GU935194.1
GU935193.1-matK N/A GU935193.1
GU935192.1-matK N/A GU935192.1
GU935191.1-matK N/A GU935191.1
GU935190.1-matK N/A GU935190.1
AF403556.1-matK N/A AF403556.1
HQ325742.1-matK N/A HQ325742.1

Sequence(s):
>NC_023215.1-matK1515
atggaggaatttcaagtatatttagaactaaatagatcccgccgacacgatttcctatacccacttatttttcgggagta
tatttatgcacttgctcatgagcatggtttaaataaatcgatgattttttttgaaaatcagggttctggtaataaattca
gttcactaattgtgaaacgtttaattcttcgaatggatcaacagaatcgtttgattagttctgctaatgattccaaccaa
aatccggtttttggacacaacaataatttgtattctcaaatgatagcggcaggatttgcagtcattgtggaaattccatt
ttccttacgattaatatcttactcacaaggggcagaagccgcaaaatctcataattttcaatcaattcattcaatatttc
cttttttagaggacaaattctcacatttaaattatgtgttagaggcactaatacctcatcccatccatctagaaatctta
gttcaagcccttcgctactgggtaaaagatgcttcttctttgcatttattacggttctctctctacgagtattgtaattt
gaagagttttattactccaaagaaatctatttctatttttaatccaagattattcttgttcctgtataattctcatacat
gtgaatacgaatctattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggagtctttcttgaa
cgaatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaa
agaccctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagt
ggaaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaatta
tctaaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctaga
aaattcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtcta
aggcgaaattttgtaacacattagggcaccccattagtaagccgacgtgggccgattcccccgattctgatattattgac
cgatttgtgcgtatatccagaaatctttctcattatcacagtggatcttcaaaaaaaaaaagtttgtatcgaataaaata
tatacttcggttttcttgtgttaaaactttggctcgtaaacacaaaagtactgtccgtgcttttttgaaaaaattaggtt
cggaatttttggaagaattctttacggaaacggaagaagaacatgttttttctttgatcttcccaagaggtttttttgct
ttgcgaaaggtctataggggacgaatttggtatttggatattatttgtatcaatgctctggtcaatcattcatga
back to top
>JX517350.1-matK749
tcttctttgcatttattacggttctctctctacgagtattgtaatttgaagagttttattactccaaagaaatctatttc
gatttttaatccaagattattcttgttcctatataattctcatacatgtgaatacgaatccattttcctttttctccgta
atcaatcttctcatttacgatcaacatcttctggggtctttcttgaacgaatttttttctatggaaaaataaagtatctt
ggcgaagtcttttataataaggattttcaggccattctatggttgtgcaaagaccctttcatacattttattaggtatca
aggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtggaaatattactttgtcgatttatggcaat
attatttttacctgtggtctcaatcaggaagagtccgtataaatcaattatctaaatattctctcgactttctgggctat
ctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaaattcatttctaatagataatgctgtgaa
gacgttggatacaagaattccaattatttcgctcattggatcattgtctaaggcgaaattttgtaacacattagggcatc
ccattagtaagccgacgtgggccgattcccccgattctgatattattgaccgatttgtgcggatatccagaaatctttct
cattatcacagtggatcttcaaaaaaaaa
back to top
>JN201400.1-matK773
tcttctttgcatttattacggttctctctctacgagtattgtaatttgaagagttttattactccaaagaaatctatttc
gatttttaatccaagattattcttgttcctatataattctcatacatgtgaatacgaatccattttcctttttctccgta
atcaatcttctcatttacgatcaacatcttctggggtctttcttgaacgaatttttttctatggaaaaataaagtatctt
ggcgaagtcttttataatgattttcagaacaacctatggttgttcaaagaccctttcatacattttattaggtatcaagg
aaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtggaaatattactttgtcgatttatggcaatatt
atttttacctgtggtctcaatcaggaagagtccgtataaatcaattatctaaatattctctcgactttctgggctatctt
tcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaaattcatttctaatagataatgctgtgaagac
gttggatacaagaattccaattatttcgctcattggatcattgtctaaggcgaaattttgtaacacattagggcatccca
ttagtaagccgacgtgggccgattcccccgattctgatattattgaccgatttgtgcggatatccagaaatctttctcat
tatcacagtggatcttcaaaaaaaaaaagtttgtatcgaataaaatatatact
back to top
>JN201399.1-matK773
tcttctttgcatttattacggttctctctctacgagtattgtaatttgaagagttttattactccaaagaaatctatttc
gatttttaatccaagattattcttgttcctatataattctcatacatgtgaatacgaatccattttcctttttctccgta
atcaatcttctcatttacgatcaacatcttctggggtctttcttgaacgaatttttttctatggaaaaataaagtatctt
ggcgaagtcttttataatgattttcagaacaacctatggttgttcaaagaccctttcatacattttattaggtatcaagg
aaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtggaaatattactttgtcgatttatggcaatatt
atttttacctgtggtctcaatcaggaagagtccgtataaatcaattatctaaatattctctcgactttctgggctatctt
tcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaaattcatttctaatagataatgctgtgaagac
gttggatacaagaattccaattatttcgctcattggatcattgtctaaggcgaaattttgtaacacattagggcatccca
ttagtaagccgacgtgggccgattcccccgattctgatattattgaccgatttgtgcggatatccagaaatctttctcat
tatcacagtggatcttcaaaaaaaaaaagtttgtatcgaataaaatatatact
back to top
>JN201398.1-matK772
tcttctttgcatttattacggttctctctctacgagtattgtaatttgaagagttttattactccaaagaaatctatttc
gatttttaatccaagattattcttgttcctatataattctcatacatgtgaatacgaatccattttcctttttctccgta
atcaatcttctcatttacgatcaacatcttctggggtctttcttgaacgaatttttttctatggaaaaataaagtatctt
ggcgaagtcttttataatgattttcagaacaacctatggttgttcaaagaccctttcatacattttattaggtatcaagg
aaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtggaaatattactttgtcgatttatggcaatatt
atttttacctgtggtctcaatcaggaagagtccgtataaatcaattatctaaatattctctcgactttctgggctatctt
tcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaaattcatttctaatagataatgctgtgaagac
gttggatacaagaattccaattatttcgctcattggatcattgtctaaggcgaaattttgtaacacattagggcatccca
ttagtaagccgacgtgggccgattcccccgattctgatattattgaccgatttgtgcggatatccagaaatctttctcat
tatcacagtggatcttcaaaaaaaaaaagtttgtatcgaataaaatatatac
back to top
>JN201397.1-matK773
tcttctttgcntttattacggttctctctctacgagtattgtaatttgaagagttttattactccaaagaaatctatttc
gatttttaatccaagattattcttgttcctatataattctcatacatgtgaatacgaatccattttcctttttctccgta
atcaatcttctcatttacgatcaacatcttctggggtctttcttgaacgaatttttttctatggaaaaataaagtatctt
ggcgaagtcttttataatgattttcagaacaacctatggttgttcaaagaccctttcatacattttattaggtatcaagg
aaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtggaaatattactttgtcgatttatggcaatatt
atttttacctgtggtctcaatcaggaagagtccgtataaatcaattatctaaatattctctcgactttctgggctatctt
tcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaaattcatttctaatagataatgctgtgaagac
gttggatacaagaattccaattatttcgctcattggatcattgtctaaggcgaaattttgtaacacattagggcatccca
ttagtaagccgacgtgggccgattcccccgattctgatattattgaccgatttgtgcggatatccagaaatctttctcat
tatcacagtggatcttcaaaaaaaaaaagtttgtatcgaataaaatatatact
back to top
>JN201396.1-matK773
tcttctttgcatttattacggttctctctctacgagtattgtaatttgaagagttttattactccaaagaaatctatttc
gatttttaatccaagattattcttgttcctatataattctcatacatgtgaatacgaatccattttcctttttctccgta
atcaatcttctcatttacgatcaacatcttctggggtctttcttgaacgaatttttttctatggaaaaataaagtatctt
ggcgaagtcttttataatgattttcagaacaacctatggttgttcaaagaccctttcatacattttattaggtatcaagg
aaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtggaaatattactttgtcgatttatggcaatatt
atttttacctgtggtctcaatcaggaagagtccgtataaatcaattatctaaatattctctcgactttctgggctatctt
tcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaaattcatttctaatagataatgctgtgaagac
gttggatacaagaattccaattatttcgctcattggatcattgtctaaggcgaaattttgtaacacattagggcatccca
ttagtaagccgacgtgggccgattcccccgattctgatattattgaccgatttgtgcggatatccagaaatctttctcat
tatcacagtggatcttcaaaaaaaaaaagtttgtatcgaataaaatatatact
back to top
>JN201395.1-matK773
tcttctttgcatttattacggttctctctctacgagtattgtaatttgaagagttttattactccaaagaaatctatttc
gatttttaatccaagattattcttgttcctatataattctcatacatgtgaatacgaatccattttcctttttctccgta
atcaatcttctcatttacgatcaacatcttctggggtctttcttgaacgaatttttttctatggaaaaataaagtatctt
ggcgaagtcttttataatgattttcagaacaacctatggttgttcaaagaccctttcatacattttattaggtatcaagg
aaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtggaaatattactttgtcgatttatggcaatatt
atttttacctgtggtctcaatcaggaagagtccgtataaatcaattatctaaatattctctcgactttctgggctatctt
tcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaaattcatttctaatagataatgctgtgaagac
gttggatacaagaattccaattatttcgctcattggatcattgtctaaggcgaaattttgtaacacattagggcatccca
ttagtaagccgacgtgggccgattcccccgattctgatattattgaccgatttgtgcggatatccagaaatctttctcat
tatcacagtggatcttcaaaaaaaaaaagtttgtatcgaataaaatatatact
back to top
>JN201394.1-matK773
tcttctttgcatttattacggttctctctctacgagtattgtaatttgaagagttttattactccaaagaaatctatttc
gatttttaatccaagattattcttgttcctatataattctcatacatgtgaatacgaatccattttcctttttctccgta
atcaatcttctcatttacgatcaacatcttctggggtctttcttgaacgaatttttttctatggaaaaataaagtatctt
ggcgaagtcttttataatgattttcagaacaacctatggttgttcaaagaccctttcatacattttattaggtatcaagg
aaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtggaaatattactttgtcgatttatggcaatatt
atttttacctgtggtctcaatcaggaagagtccgtataaatcaattatctaaatattctctcgactttctgggctatctt
tcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaaattcatttctaatagataatgctgtgaagac
gttggatacaagaattccaattatttcgctcattggatcattgtctaaggcgaaattttgtaacacattagggcatccca
ttagtaagccgacgtgggccgattcccccgattctgatattattgaccgatttgtgcggatatccagaaatctttctcat
tatcacagtggatcttcaaaaaaaaaaagtttgtatcgaataaaatatatact
back to top
>JN201393.1-matK773
tcttctttgcatttattacggttctctctctacgagtattgtaatttgaagagttttattactccaaagaaatctatttc
gatttttaatccaagattattcttgttcctatataattctcatacatgtgaatacgaatccattttcctttttctccgta
atcaatcttctcatttacgatcaacatcttctggggtctttcttgaacgaatttttttctatggaaaaataaagtatctt
ggcgaagtcttttataatgattttcagaacaacctatggttgttcaaagaccctttcatacattttattaggtatcaagg
aaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtggaaatattactttgtcgatttatggcaatatt
atttttacctgtggtctcaatcaggaagagtccgtataaatcaattatctaaatattctctcgactttctgggctatctt
tcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaaattcatttctaatagataatgctgtgaagac
gttggatacaagaattccaattatttcgctcattggatcattgtctaaggcgaaattttgtaacacattagggcatccca
ttagtaagccgacgtgggccgattcccccgattctgatattattgaccgatttgtgcggatatccagaaatctttctcat
tatcacagtggatcttcaaaaaaaaaaagtttgtatcgaataaaatatatact
back to top
>JN201392.1-matK773
tcttctttgcatttattacggttctctctctacgagtattgtaatttgaagagttttattactccaaagaaatctatttc
gatttttaatccaagattattcttgttcctatataattctcatacatgtgaatacgaatccattttcctttttctccgta
atcaatcttctcatttacgatcaacatcttctggggtctttcttgaacgaatttttttctatggaaaaataaagtatctt
ggcgaagtcttttataatgattttcagaacaacctatggttgttcaaagaccctttcatacattttattaggtatcaagg
aaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtggaaatattactttgtcgatttatggcaatatt
atttttacctgtggtctcaatcaggaagagtccgtataaatcaattatctaaatattctctcgactttctgggctatctt
tcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaaattcatttctaatagataatgctgtgaagac
gttggatacaagaattccaattatttcgctcattggatcattgtctaaggcgaaattttgtaacacattagggcatccca
ttagtaagccgacgtgggccgattcccccgattctgatattattgaccgatttgtgcggatatccagaaatctttctcat
tatcacagtggatcttcaaaaaaaaaaagtttgtatcgaataaaatatatact
back to top
>JN201391.1-matK773
tcttctttgcatttattacggttctctctctacgagtattgtaatttgaagagttttattactccaaagaaatctatttc
gatttttaatccaagattattcttgttcctatataattctcatacatgtgaatacgaatccattttcctttttctccgta
atcaatcttctcatttacgatcaacatcttctggggtctttcttgaacgaatttttttctatggaaaaataaagtatctt
ggcgaagtcttttataatgattttcagaacaacctatggttgttcaaagaccctttcatacattttattaggtatcaagg
aaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtggaaatattactttgtcgatttatggcaatatt
atttttacctgtggtctcaatcaggaagagtccgtataaatcaattatctaaatattctctcgactttctgggctatctt
tcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaaattcatttctaatagataatgctgtgaagac
gttggatacaagaattccaattatttcgctcattggatcattgtctaaggcgaaattttgtaacacattagggcatccca
ttagtaagccgacgtgggccgattcccccgattctgatattattgaccgatttgtgcggatatccagaaatctttctcat
tatcacagtggatcttcaaaaaaaaaaagtttgtatcgaataaaatatatact
back to top
>NC_016692.1-matK1515
atggaggaatttcaagtatatttagaactaaatagatcccgccgacacgatttcctatacccacttatttttcgggagta
tatttatgcacttgctcatgagcatggtttaaataaatcgatgattttttttgaaaatcagggttatggtaataaattca
gttcactaattgtgaaacgtttaattcttcgaatggatcaacagaatcgtttgattagttctgctaatgattccaaccaa
aatccggtttttgggcacaacaataatttgtattctcaaatgatagcggtaggatttgcagtcattgtggaaattccatt
ttccttacgattaatatcttactcacaaggggcagaagtcgcaaaatctcataatttacaatcaattcattcaatatttc
cttttttagaggacaaattctcacatttaaattatgtgttagaggcactaatacctcatcccatccatctagaaatctta
gttcaagcccttcgctactgggtaaaagatgcttcttctttgcatttattacggttctctctctacgagtattgtaattt
gaagagttttattactccaaagaaatctatttcgatttttaatccaagattattcttgttcctatataattctcatacat
gtgaatacgaatccattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggggtctttcttgaa
cgaatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaa
agaccctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagt
ggaaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaatta
tctaaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctaga
aaattcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtcta
aggcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggccgattcccccgattctgatattattgac
cgatttgtgcggatatccagaaatctttctcattatcacagtggatcttcaaaaaaaaaaagtttgtatcgaataaaata
tatacttcggttttcttgtgttaaaactttggctcgtaaacacaaaagtactgtccgtgcttttttgaaaaaattaggtt
cggaatttttggaagaattctttacggaaacggaagaagaacatgttttttctttgatcttcccaagaggtttttttgct
atgcgaaaggtctataggggacgaatttggtatttggatattatttgtatcaatgctctggtcaatcattcatga
back to top
>JF270794.1-matK705
tcttctttgcatttattacggttctctctctacgagtattgtaatttgaagagttttattactccaaagaaatctatttc
gatttttaatccaagattattcttgttcctatataattctcatacatgtgaatacgaatccattttcctttttctccgta
atcaatcttctcatttacgatcaacatcttctggggtctttcttgaacgaatttttttctatggaaaaataaagtatctt
ggcgaagtcttttataatgattttcagaacaacctatggttgttcaaagaccctttcatacattttattaggtatcaagg
aaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtggaaatattactttgtcgatttatggcaatatt
atttttacctgtggtctcaatcaggaagagtccgtataaatcaattatctaaatattctctcgactttctgggctatctt
tcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaaattcatttctaatagataatgctgtgaagac
gttggatacaagaattccaattatttcgctcattggatcattgtctaaggcgaaattttgtaacacattagggcatccca
ttagtaagccgacgtgggccgattcccccgattctgatattattgaccgatttgtgcggatatcc
back to top
>JF317353.1-matK.m31515
atggaggaatttcaagtatatttagaactaaatagatcccgccgacacgatttcctatacccacttatttttcgggagta
tatttatgcacttgctcatgagcatggtttaaataaatcgatgattttttttgaaaatcagggttctggtaataaattca
gttcactaattgtgaaacgtttaattcttcgaatggatcaacagaatcgtttgattagttctgctaatgattccaaccaa
aatccggtttttggacacaacaataatttgtattctcaaatgatagcggcaggatttgcagtcattgtggaaattccatt
ttccttacgattaatatcttactcacaaggggcagaagccgcaaaatctcataattttcaatcaattcattcaatatttc
cttttttagaggacaaattctcacatttaaattatgtgttagaggcactaatacctcatcccatccatctagaaatctta
gttcaagcccttcgctactgggtaaaagatgcttcttctttgcatttattacggttctctctctacgagtattgtaattt
gaagagttttattactccaaagaaatctatttctatttttaatccaagattattcttgttcctgtataattctcatacat
gtgaatacgaatctattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggagtctttcttgaa
cgaatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaa
agaccctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagt
ggaaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaatta
tctaaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctaga
aaattcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtcta
aggcgaaattttgtaacacattagggcaccccattagtaagccgacgtgggccgattcccccgattctgatattattgac
cgatttgtgcgtatatccagaaatctttctcattatcacagtggatcttcaaaaaaaaaaagtttgtatcgaataaaata
tatacttcggttttcttgtgttaaaactttggctcgtaaacacaaaagtactgtccgtgcttttttgaaaaaattaggtt
cggaatttttggaagaattctttacggaaacggaagaagaacatgttttttctttgatcttcccaagaggtttttttgct
ttgcgaaaggtctataggggacgaatttggtatttggatattatttgtatcaatgctctggtcaatcattcatga
back to top
>GU935202.1-matK.m1637
agagttttattactccaaagaaatctatttcgatttttaatccaagattattcttgttcctatataattctcatacatgt
gaatacgaatccattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggggtctttcttgaacg
aatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaaag
accctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtgg
aaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaattatc
taaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaa
attcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtctaag
gcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggccgattcccccgattctgatattattga
back to top
>GU935201.1-matK.m1637
agagttttattactccaaagaaatctatttcgatttttaatccaagattattcttgttcctatataattctcatacatgt
gaatacgaatccattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggggtctttcttgaacg
aatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaaag
accctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtgg
aaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaattatc
taaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaa
attcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtctaag
gcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggccgattcccccgattctgatattattga
back to top
>GU935200.1-matK.m1637
agagttttattactccaaagaaatctatttcgatttttaatccaagattattcttgttcctatataattctcatacatgt
gaatacgaatccattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggggtctttcttgaacg
aatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaaag
accctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtgg
aaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaattatc
taaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaa
attcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtctaag
gcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggccgattcccccgattctgatattattga
back to top
>GU935199.1-matK.m1637
agagttttattactccaaagaaatctatttcgatttttaatccaagattattcttgttcctatataattctcatacatgt
gaatacgaatccattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggggtctttcttgaacg
aatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaaag
accctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtgg
aaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaattatc
taaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaa
attcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtctaag
gcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggccgattcccccgattctgatattattga
back to top
>GU935198.1-matK.m1637
agagttttattactccaaagaaatctatttcgatttttaatccaagattattcttgttcctatataattctcatacatgt
gaatacgaatccattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggggtctttcttgaacg
aatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaaag
accctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtgg
aaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaattatc
taaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaa
attcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtctaaa
gcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggccgattcccccgattctgatattattga
back to top
>GU935197.1-matK.m1637
agagttttattactccaaagaaatctatttcgatttttaatccaagattattcttgttcctatataattctcatacatgt
gaatacgaatccattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggggtctttcttgaacg
aatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaaag
accctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtgg
aaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaattatc
taaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaa
attcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtctaag
gcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggccgattcccccgattctgatattattga
back to top
>GU935196.1-matK.m1637
agagttttattactccaaagaaatctatttcgatttttaatccaagattattcttgttcctatataattctcatacatgt
gaatacgaatccattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggggtctttcttgaacg
aatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaaag
accctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtgg
aaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaattatc
taaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaa
attcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtctaag
gcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggccgattcccccgattctgatattattga
back to top
>GU935195.1-matK.m1637
agagttttattactccaaagaaatctatttcgatttttaatccaagattattcttgttcctatataattctcatacatgt
gaatacgaatccattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggggtctttcttgaacg
aatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaaag
accctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtgg
aaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaattatc
taaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaa
attcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtctaag
gcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggccgattcccccgattctgatattattga
back to top
>GU935194.1-matK.m1637
agagttttattactccaaagaaatctatttcgatttttaatccaagattattcttgttcctatataattctcatacatgt
gaatacgaatccattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggggtctttcttgaacg
aatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaaag
accctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtgg
aaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaattatc
taaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaa
attcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtctaag
gcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggccgattcccccgattctgatattattga
back to top
>GU935193.1-matK.m1637
agagttttattactccaaagaaatctatttcgatttttaatccaagattattcttgttcctatataattctcatacatgt
gaatacgaatccattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggggtctttcttgaacg
aatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaaag
accctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtgg
aaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaattatc
taaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaa
attcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtctaag
gcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggccgattcccccgattctgatattattga
back to top
>GU935192.1-matK.m1637
agagttttattactccaaagaaatctatttcgatttttaatccaagattattcttgttcctatataattctcatacatgt
gaatacgaatccattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggggtctttcttgaacg
aatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaaag
accctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtgg
aaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaattatc
taaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaa
attcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtctaag
gcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggccgattcccccgattctgatattattga
back to top
>GU935191.1-matK.m1637
agagttttattactccaaagaaatctatttcgatttttaatccaagattattcttgttcctatataattctcatacatgt
gaatacgaatccattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggggtctttcttgaacg
aatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaaag
accctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtgg
aaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaattatc
taaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaa
attcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtctaag
gcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggccgattcccccgattctgatattattga
back to top
>GU935190.1-matK.m1637
agagttttattactccaaagaaatctatttcgatttttaatccaagattattcttgttcctatataattctcatacatgt
gaatacgaatccattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggggtctttcttgaacg
aatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaaag
accctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtgg
aaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaattatc
taaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaa
attcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtctaag
gcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggccgattcccccgattctgatattattga
back to top
>AF403556.1-matK.m11515
atggaggaatttcaagtatatttagaactaaatagatcccgccgacacgatttcctatacccacttatttttcgggagta
tatttatgcacttgctcatgagcatggtttaaataaatcgatgattttttttgaaaatcagggttatggtaataaattca
gttcactaattgtgaaacgtttaattcttcgaatggatcaacagaatcgtttgattagttctgctaatgattccaaccaa
aatccggtttttgggcacaacaataatttgtattctcaaatgatagcggtaggatttgcagtcattgtggaaattccatt
ttccttacgattaatatcttactcacaaggggcagaagtcgcaaaatctcataatttacaatcaattcattcaatatttc
cttttttagaggacaaattctcacatttaaattatgtgttagaggcactaatacctcatcccatccatctagaaatctta
gttcaagcccttcgctactgggtaaaagatgcttcttctttgcatttattacggttctctctctacgagtattgtaattt
gaagagttttattactccaaagaaatctatttcgatttttaatccaagattattcttgttcctatataattctcatacat
gtgaatacgaatccattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggggtctttcttgaa
cgaatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaa
agaccctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagt
ggaaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaatta
tctaaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctaga
aaattcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtcta
aggcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggccgattcccccgattctgatattattgac
cgatttgtgcggatatccagaaatctttctcattatcacagtggatcttcaaaaaaaaaaagtttgtatcgaataaaata
tatacttcggttttcttgtgttaaaactttggctcgtaaacacaaaagtactgtccgtgcttttttgaaaaaattaggtt
cggaatttttggaagaattctttacggaaacggaagaagaacatgttttttctttgatcttcccaagaggtttttttgct
atgcgaaaggtctataggggacgaatttggtatttggatattatttgtatcaatgctctggtcaatcattcatga
back to top
>HQ325742.1-matK.m31515
atggaggaatttcaagtatatttagaactaaatagatcccgccgacacgatttcctatacccacttatttttcgggagta
tatttatgcacttgctcatgagcatggtttaaataaatcgatgattttttttgaaaatcagggttatggtaataaattca
gttcactaattgtgaaacgtttaattcttcgaatggatcaacagaatcgtttgattagttctgctaatgattccaaccaa
aatccggtttttgggcacaacaataatttgtattctcaaatgatagcggtaggatttgcagtcattgtggaaattccatt
ttccttacgattaatatcttactcacaaggggcagaagtcgcaaaatctcataatttacaatcaattcattcaatatttc
cttttttagaggacaaattctcacatttaaattatgtgttagaggcactaatacctcatcccatccatctagaaatctta
gttcaagcccttcgctactgggtaaaagatgcttcttctttgcatttattacggttctctctctacgagtattgtaattt
gaagagttttattactccaaagaaatctatttcgatttttaatccaagattattcttgttcctatataattctcatacat
gtgaatacgaatccattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggggtctttcttgaa
cgaatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaa
agaccctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagt
ggaaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaatta
tctaaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctaga
aaattcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtcta
aggcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggccgattcccccgattctgatattattgac
cgatttgtgcggatatccagaaatctttctcattatcacagtggatcttcaaaaaaaaaaagtttgtatcgaataaaata
tatacttcggttttcttgtgttaaaactttggctcgtaaacacaaaagtactgtccgtgcttttttgaaaaaattaggtt
cggaatttttggaagaattctttacggaaacggaagaagaacatgttttttctttgatcttcccaagaggtttttttgct
atgcgaaaggtctataggggacgaatttggtatttggatattatttgtatcaatgctctggtcaatcattcatga
back to top
>NC_023215.1-matK.m31515
atggaggaatttcaagtatatttagaactaaatagatcccgccgacacgatttcctatacccacttatttttcgggagta
tatttatgcacttgctcatgagcatggtttaaataaatcgatgattttttttgaaaatcagggttctggtaataaattca
gttcactaattgtgaaacgtttaattcttcgaatggatcaacagaatcgtttgattagttctgctaatgattccaaccaa
aatccggtttttggacacaacaataatttgtattctcaaatgatagcggcaggatttgcagtcattgtggaaattccatt
ttccttacgattaatatcttactcacaaggggcagaagccgcaaaatctcataattttcaatcaattcattcaatatttc
cttttttagaggacaaattctcacatttaaattatgtgttagaggcactaatacctcatcccatccatctagaaatctta
gttcaagcccttcgctactgggtaaaagatgcttcttctttgcatttattacggttctctctctacgagtattgtaattt
gaagagttttattactccaaagaaatctatttctatttttaatccaagattattcttgttcctgtataattctcatacat
gtgaatacgaatctattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggagtctttcttgaa
cgaatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaa
agaccctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagt
ggaaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaatta
tctaaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctaga
aaattcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtcta
aggcgaaattttgtaacacattagggcaccccattagtaagccgacgtgggccgattcccccgattctgatattattgac
cgatttgtgcgtatatccagaaatctttctcattatcacagtggatcttcaaaaaaaaaaagtttgtatcgaataaaata
tatacttcggttttcttgtgttaaaactttggctcgtaaacacaaaagtactgtccgtgcttttttgaaaaaattaggtt
cggaatttttggaagaattctttacggaaacggaagaagaacatgttttttctttgatcttcccaagaggtttttttgct
ttgcgaaaggtctataggggacgaatttggtatttggatattatttgtatcaatgctctggtcaatcattcatga
back to top
>JX517350.1-matK.m1749
tcttctttgcatttattacggttctctctctacgagtattgtaatttgaagagttttattactccaaagaaatctatttc
gatttttaatccaagattattcttgttcctatataattctcatacatgtgaatacgaatccattttcctttttctccgta
atcaatcttctcatttacgatcaacatcttctggggtctttcttgaacgaatttttttctatggaaaaataaagtatctt
ggcgaagtcttttataataaggattttcaggccattctatggttgtgcaaagaccctttcatacattttattaggtatca
aggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtggaaatattactttgtcgatttatggcaat
attatttttacctgtggtctcaatcaggaagagtccgtataaatcaattatctaaatattctctcgactttctgggctat
ctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaaattcatttctaatagataatgctgtgaa
gacgttggatacaagaattccaattatttcgctcattggatcattgtctaaggcgaaattttgtaacacattagggcatc
ccattagtaagccgacgtgggccgattcccccgattctgatattattgaccgatttgtgcggatatccagaaatctttct
cattatcacagtggatcttcaaaaaaaaa
back to top
>JN201400.1-matK.m1773
tcttctttgcatttattacggttctctctctacgagtattgtaatttgaagagttttattactccaaagaaatctatttc
gatttttaatccaagattattcttgttcctatataattctcatacatgtgaatacgaatccattttcctttttctccgta
atcaatcttctcatttacgatcaacatcttctggggtctttcttgaacgaatttttttctatggaaaaataaagtatctt
ggcgaagtcttttataatgattttcagaacaacctatggttgttcaaagaccctttcatacattttattaggtatcaagg
aaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtggaaatattactttgtcgatttatggcaatatt
atttttacctgtggtctcaatcaggaagagtccgtataaatcaattatctaaatattctctcgactttctgggctatctt
tcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaaattcatttctaatagataatgctgtgaagac
gttggatacaagaattccaattatttcgctcattggatcattgtctaaggcgaaattttgtaacacattagggcatccca
ttagtaagccgacgtgggccgattcccccgattctgatattattgaccgatttgtgcggatatccagaaatctttctcat
tatcacagtggatcttcaaaaaaaaaaagtttgtatcgaataaaatatatact
back to top
>JN201399.1-matK.m1773
tcttctttgcatttattacggttctctctctacgagtattgtaatttgaagagttttattactccaaagaaatctatttc
gatttttaatccaagattattcttgttcctatataattctcatacatgtgaatacgaatccattttcctttttctccgta
atcaatcttctcatttacgatcaacatcttctggggtctttcttgaacgaatttttttctatggaaaaataaagtatctt
ggcgaagtcttttataatgattttcagaacaacctatggttgttcaaagaccctttcatacattttattaggtatcaagg
aaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtggaaatattactttgtcgatttatggcaatatt
atttttacctgtggtctcaatcaggaagagtccgtataaatcaattatctaaatattctctcgactttctgggctatctt
tcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaaattcatttctaatagataatgctgtgaagac
gttggatacaagaattccaattatttcgctcattggatcattgtctaaggcgaaattttgtaacacattagggcatccca
ttagtaagccgacgtgggccgattcccccgattctgatattattgaccgatttgtgcggatatccagaaatctttctcat
tatcacagtggatcttcaaaaaaaaaaagtttgtatcgaataaaatatatact
back to top
>JN201398.1-matK.m1772
tcttctttgcatttattacggttctctctctacgagtattgtaatttgaagagttttattactccaaagaaatctatttc
gatttttaatccaagattattcttgttcctatataattctcatacatgtgaatacgaatccattttcctttttctccgta
atcaatcttctcatttacgatcaacatcttctggggtctttcttgaacgaatttttttctatggaaaaataaagtatctt
ggcgaagtcttttataatgattttcagaacaacctatggttgttcaaagaccctttcatacattttattaggtatcaagg
aaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtggaaatattactttgtcgatttatggcaatatt
atttttacctgtggtctcaatcaggaagagtccgtataaatcaattatctaaatattctctcgactttctgggctatctt
tcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaaattcatttctaatagataatgctgtgaagac
gttggatacaagaattccaattatttcgctcattggatcattgtctaaggcgaaattttgtaacacattagggcatccca
ttagtaagccgacgtgggccgattcccccgattctgatattattgaccgatttgtgcggatatccagaaatctttctcat
tatcacagtggatcttcaaaaaaaaaaagtttgtatcgaataaaatatatac
back to top
>JN201397.1-matK.m1773
tcttctttgcntttattacggttctctctctacgagtattgtaatttgaagagttttattactccaaagaaatctatttc
gatttttaatccaagattattcttgttcctatataattctcatacatgtgaatacgaatccattttcctttttctccgta
atcaatcttctcatttacgatcaacatcttctggggtctttcttgaacgaatttttttctatggaaaaataaagtatctt
ggcgaagtcttttataatgattttcagaacaacctatggttgttcaaagaccctttcatacattttattaggtatcaagg
aaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtggaaatattactttgtcgatttatggcaatatt
atttttacctgtggtctcaatcaggaagagtccgtataaatcaattatctaaatattctctcgactttctgggctatctt
tcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaaattcatttctaatagataatgctgtgaagac
gttggatacaagaattccaattatttcgctcattggatcattgtctaaggcgaaattttgtaacacattagggcatccca
ttagtaagccgacgtgggccgattcccccgattctgatattattgaccgatttgtgcggatatccagaaatctttctcat
tatcacagtggatcttcaaaaaaaaaaagtttgtatcgaataaaatatatact
back to top
>JN201396.1-matK.m1773
tcttctttgcatttattacggttctctctctacgagtattgtaatttgaagagttttattactccaaagaaatctatttc
gatttttaatccaagattattcttgttcctatataattctcatacatgtgaatacgaatccattttcctttttctccgta
atcaatcttctcatttacgatcaacatcttctggggtctttcttgaacgaatttttttctatggaaaaataaagtatctt
ggcgaagtcttttataatgattttcagaacaacctatggttgttcaaagaccctttcatacattttattaggtatcaagg
aaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtggaaatattactttgtcgatttatggcaatatt
atttttacctgtggtctcaatcaggaagagtccgtataaatcaattatctaaatattctctcgactttctgggctatctt
tcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaaattcatttctaatagataatgctgtgaagac
gttggatacaagaattccaattatttcgctcattggatcattgtctaaggcgaaattttgtaacacattagggcatccca
ttagtaagccgacgtgggccgattcccccgattctgatattattgaccgatttgtgcggatatccagaaatctttctcat
tatcacagtggatcttcaaaaaaaaaaagtttgtatcgaataaaatatatact
back to top
>JN201395.1-matK.m1773
tcttctttgcatttattacggttctctctctacgagtattgtaatttgaagagttttattactccaaagaaatctatttc
gatttttaatccaagattattcttgttcctatataattctcatacatgtgaatacgaatccattttcctttttctccgta
atcaatcttctcatttacgatcaacatcttctggggtctttcttgaacgaatttttttctatggaaaaataaagtatctt
ggcgaagtcttttataatgattttcagaacaacctatggttgttcaaagaccctttcatacattttattaggtatcaagg
aaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtggaaatattactttgtcgatttatggcaatatt
atttttacctgtggtctcaatcaggaagagtccgtataaatcaattatctaaatattctctcgactttctgggctatctt
tcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaaattcatttctaatagataatgctgtgaagac
gttggatacaagaattccaattatttcgctcattggatcattgtctaaggcgaaattttgtaacacattagggcatccca
ttagtaagccgacgtgggccgattcccccgattctgatattattgaccgatttgtgcggatatccagaaatctttctcat
tatcacagtggatcttcaaaaaaaaaaagtttgtatcgaataaaatatatact
back to top
>JN201394.1-matK.m1773
tcttctttgcatttattacggttctctctctacgagtattgtaatttgaagagttttattactccaaagaaatctatttc
gatttttaatccaagattattcttgttcctatataattctcatacatgtgaatacgaatccattttcctttttctccgta
atcaatcttctcatttacgatcaacatcttctggggtctttcttgaacgaatttttttctatggaaaaataaagtatctt
ggcgaagtcttttataatgattttcagaacaacctatggttgttcaaagaccctttcatacattttattaggtatcaagg
aaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtggaaatattactttgtcgatttatggcaatatt
atttttacctgtggtctcaatcaggaagagtccgtataaatcaattatctaaatattctctcgactttctgggctatctt
tcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaaattcatttctaatagataatgctgtgaagac
gttggatacaagaattccaattatttcgctcattggatcattgtctaaggcgaaattttgtaacacattagggcatccca
ttagtaagccgacgtgggccgattcccccgattctgatattattgaccgatttgtgcggatatccagaaatctttctcat
tatcacagtggatcttcaaaaaaaaaaagtttgtatcgaataaaatatatact
back to top
>JN201393.1-matK.m1773
tcttctttgcatttattacggttctctctctacgagtattgtaatttgaagagttttattactccaaagaaatctatttc
gatttttaatccaagattattcttgttcctatataattctcatacatgtgaatacgaatccattttcctttttctccgta
atcaatcttctcatttacgatcaacatcttctggggtctttcttgaacgaatttttttctatggaaaaataaagtatctt
ggcgaagtcttttataatgattttcagaacaacctatggttgttcaaagaccctttcatacattttattaggtatcaagg
aaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtggaaatattactttgtcgatttatggcaatatt
atttttacctgtggtctcaatcaggaagagtccgtataaatcaattatctaaatattctctcgactttctgggctatctt
tcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaaattcatttctaatagataatgctgtgaagac
gttggatacaagaattccaattatttcgctcattggatcattgtctaaggcgaaattttgtaacacattagggcatccca
ttagtaagccgacgtgggccgattcccccgattctgatattattgaccgatttgtgcggatatccagaaatctttctcat
tatcacagtggatcttcaaaaaaaaaaagtttgtatcgaataaaatatatact
back to top
>JN201392.1-matK.m1773
tcttctttgcatttattacggttctctctctacgagtattgtaatttgaagagttttattactccaaagaaatctatttc
gatttttaatccaagattattcttgttcctatataattctcatacatgtgaatacgaatccattttcctttttctccgta
atcaatcttctcatttacgatcaacatcttctggggtctttcttgaacgaatttttttctatggaaaaataaagtatctt
ggcgaagtcttttataatgattttcagaacaacctatggttgttcaaagaccctttcatacattttattaggtatcaagg
aaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtggaaatattactttgtcgatttatggcaatatt
atttttacctgtggtctcaatcaggaagagtccgtataaatcaattatctaaatattctctcgactttctgggctatctt
tcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaaattcatttctaatagataatgctgtgaagac
gttggatacaagaattccaattatttcgctcattggatcattgtctaaggcgaaattttgtaacacattagggcatccca
ttagtaagccgacgtgggccgattcccccgattctgatattattgaccgatttgtgcggatatccagaaatctttctcat
tatcacagtggatcttcaaaaaaaaaaagtttgtatcgaataaaatatatact
back to top
>JN201391.1-matK.m1773
tcttctttgcatttattacggttctctctctacgagtattgtaatttgaagagttttattactccaaagaaatctatttc
gatttttaatccaagattattcttgttcctatataattctcatacatgtgaatacgaatccattttcctttttctccgta
atcaatcttctcatttacgatcaacatcttctggggtctttcttgaacgaatttttttctatggaaaaataaagtatctt
ggcgaagtcttttataatgattttcagaacaacctatggttgttcaaagaccctttcatacattttattaggtatcaagg
aaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtggaaatattactttgtcgatttatggcaatatt
atttttacctgtggtctcaatcaggaagagtccgtataaatcaattatctaaatattctctcgactttctgggctatctt
tcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaaattcatttctaatagataatgctgtgaagac
gttggatacaagaattccaattatttcgctcattggatcattgtctaaggcgaaattttgtaacacattagggcatccca
ttagtaagccgacgtgggccgattcccccgattctgatattattgaccgatttgtgcggatatccagaaatctttctcat
tatcacagtggatcttcaaaaaaaaaaagtttgtatcgaataaaatatatact
back to top
>NC_016692.1-matK.m31515
atggaggaatttcaagtatatttagaactaaatagatcccgccgacacgatttcctatacccacttatttttcgggagta
tatttatgcacttgctcatgagcatggtttaaataaatcgatgattttttttgaaaatcagggttatggtaataaattca
gttcactaattgtgaaacgtttaattcttcgaatggatcaacagaatcgtttgattagttctgctaatgattccaaccaa
aatccggtttttgggcacaacaataatttgtattctcaaatgatagcggtaggatttgcagtcattgtggaaattccatt
ttccttacgattaatatcttactcacaaggggcagaagtcgcaaaatctcataatttacaatcaattcattcaatatttc
cttttttagaggacaaattctcacatttaaattatgtgttagaggcactaatacctcatcccatccatctagaaatctta
gttcaagcccttcgctactgggtaaaagatgcttcttctttgcatttattacggttctctctctacgagtattgtaattt
gaagagttttattactccaaagaaatctatttcgatttttaatccaagattattcttgttcctatataattctcatacat
gtgaatacgaatccattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggggtctttcttgaa
cgaatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaa
agaccctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagt
ggaaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaatta
tctaaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctaga
aaattcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtcta
aggcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggccgattcccccgattctgatattattgac
cgatttgtgcggatatccagaaatctttctcattatcacagtggatcttcaaaaaaaaaaagtttgtatcgaataaaata
tatacttcggttttcttgtgttaaaactttggctcgtaaacacaaaagtactgtccgtgcttttttgaaaaaattaggtt
cggaatttttggaagaattctttacggaaacggaagaagaacatgttttttctttgatcttcccaagaggtttttttgct
atgcgaaaggtctataggggacgaatttggtatttggatattatttgtatcaatgctctggtcaatcattcatga
back to top
>JF270794.1-matK.m1705
tcttctttgcatttattacggttctctctctacgagtattgtaatttgaagagttttattactccaaagaaatctatttc
gatttttaatccaagattattcttgttcctatataattctcatacatgtgaatacgaatccattttcctttttctccgta
atcaatcttctcatttacgatcaacatcttctggggtctttcttgaacgaatttttttctatggaaaaataaagtatctt
ggcgaagtcttttataatgattttcagaacaacctatggttgttcaaagaccctttcatacattttattaggtatcaagg
aaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtggaaatattactttgtcgatttatggcaatatt
atttttacctgtggtctcaatcaggaagagtccgtataaatcaattatctaaatattctctcgactttctgggctatctt
tcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaaattcatttctaatagataatgctgtgaagac
gttggatacaagaattccaattatttcgctcattggatcattgtctaaggcgaaattttgtaacacattagggcatccca
ttagtaagccgacgtgggccgattcccccgattctgatattattgaccgatttgtgcggatatcc
back to top
>JF317353.1-matK1515
atggaggaatttcaagtatatttagaactaaatagatcccgccgacacgatttcctatacccacttatttttcgggagta
tatttatgcacttgctcatgagcatggtttaaataaatcgatgattttttttgaaaatcagggttctggtaataaattca
gttcactaattgtgaaacgtttaattcttcgaatggatcaacagaatcgtttgattagttctgctaatgattccaaccaa
aatccggtttttggacacaacaataatttgtattctcaaatgatagcggcaggatttgcagtcattgtggaaattccatt
ttccttacgattaatatcttactcacaaggggcagaagccgcaaaatctcataattttcaatcaattcattcaatatttc
cttttttagaggacaaattctcacatttaaattatgtgttagaggcactaatacctcatcccatccatctagaaatctta
gttcaagcccttcgctactgggtaaaagatgcttcttctttgcatttattacggttctctctctacgagtattgtaattt
gaagagttttattactccaaagaaatctatttctatttttaatccaagattattcttgttcctgtataattctcatacat
gtgaatacgaatctattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggagtctttcttgaa
cgaatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaa
agaccctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagt
ggaaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaatta
tctaaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctaga
aaattcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtcta
aggcgaaattttgtaacacattagggcaccccattagtaagccgacgtgggccgattcccccgattctgatattattgac
cgatttgtgcgtatatccagaaatctttctcattatcacagtggatcttcaaaaaaaaaaagtttgtatcgaataaaata
tatacttcggttttcttgtgttaaaactttggctcgtaaacacaaaagtactgtccgtgcttttttgaaaaaattaggtt
cggaatttttggaagaattctttacggaaacggaagaagaacatgttttttctttgatcttcccaagaggtttttttgct
ttgcgaaaggtctataggggacgaatttggtatttggatattatttgtatcaatgctctggtcaatcattcatga
back to top
>GU935202.1-matK637
agagttttattactccaaagaaatctatttcgatttttaatccaagattattcttgttcctatataattctcatacatgt
gaatacgaatccattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggggtctttcttgaacg
aatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaaag
accctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtgg
aaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaattatc
taaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaa
attcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtctaag
gcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggccgattcccccgattctgatattattga
back to top
>GU935201.1-matK637
agagttttattactccaaagaaatctatttcgatttttaatccaagattattcttgttcctatataattctcatacatgt
gaatacgaatccattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggggtctttcttgaacg
aatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaaag
accctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtgg
aaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaattatc
taaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaa
attcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtctaag
gcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggccgattcccccgattctgatattattga
back to top
>GU935200.1-matK637
agagttttattactccaaagaaatctatttcgatttttaatccaagattattcttgttcctatataattctcatacatgt
gaatacgaatccattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggggtctttcttgaacg
aatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaaag
accctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtgg
aaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaattatc
taaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaa
attcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtctaag
gcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggccgattcccccgattctgatattattga
back to top
>GU935199.1-matK637
agagttttattactccaaagaaatctatttcgatttttaatccaagattattcttgttcctatataattctcatacatgt
gaatacgaatccattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggggtctttcttgaacg
aatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaaag
accctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtgg
aaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaattatc
taaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaa
attcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtctaag
gcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggccgattcccccgattctgatattattga
back to top
>GU935198.1-matK637
agagttttattactccaaagaaatctatttcgatttttaatccaagattattcttgttcctatataattctcatacatgt
gaatacgaatccattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggggtctttcttgaacg
aatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaaag
accctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtgg
aaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaattatc
taaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaa
attcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtctaaa
gcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggccgattcccccgattctgatattattga
back to top
>GU935197.1-matK637
agagttttattactccaaagaaatctatttcgatttttaatccaagattattcttgttcctatataattctcatacatgt
gaatacgaatccattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggggtctttcttgaacg
aatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaaag
accctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtgg
aaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaattatc
taaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaa
attcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtctaag
gcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggccgattcccccgattctgatattattga
back to top
>GU935196.1-matK637
agagttttattactccaaagaaatctatttcgatttttaatccaagattattcttgttcctatataattctcatacatgt
gaatacgaatccattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggggtctttcttgaacg
aatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaaag
accctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtgg
aaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaattatc
taaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaa
attcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtctaag
gcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggccgattcccccgattctgatattattga
back to top
>GU935195.1-matK637
agagttttattactccaaagaaatctatttcgatttttaatccaagattattcttgttcctatataattctcatacatgt
gaatacgaatccattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggggtctttcttgaacg
aatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaaag
accctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtgg
aaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaattatc
taaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaa
attcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtctaag
gcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggccgattcccccgattctgatattattga
back to top
>GU935194.1-matK637
agagttttattactccaaagaaatctatttcgatttttaatccaagattattcttgttcctatataattctcatacatgt
gaatacgaatccattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggggtctttcttgaacg
aatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaaag
accctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtgg
aaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaattatc
taaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaa
attcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtctaag
gcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggccgattcccccgattctgatattattga
back to top
>GU935193.1-matK637
agagttttattactccaaagaaatctatttcgatttttaatccaagattattcttgttcctatataattctcatacatgt
gaatacgaatccattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggggtctttcttgaacg
aatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaaag
accctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtgg
aaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaattatc
taaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaa
attcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtctaag
gcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggccgattcccccgattctgatattattga
back to top
>GU935192.1-matK637
agagttttattactccaaagaaatctatttcgatttttaatccaagattattcttgttcctatataattctcatacatgt
gaatacgaatccattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggggtctttcttgaacg
aatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaaag
accctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtgg
aaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaattatc
taaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaa
attcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtctaag
gcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggccgattcccccgattctgatattattga
back to top
>GU935191.1-matK637
agagttttattactccaaagaaatctatttcgatttttaatccaagattattcttgttcctatataattctcatacatgt
gaatacgaatccattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggggtctttcttgaacg
aatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaaag
accctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtgg
aaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaattatc
taaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaa
attcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtctaag
gcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggccgattcccccgattctgatattattga
back to top
>GU935190.1-matK637
agagttttattactccaaagaaatctatttcgatttttaatccaagattattcttgttcctatataattctcatacatgt
gaatacgaatccattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggggtctttcttgaacg
aatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaaag
accctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagtgg
aaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaattatc
taaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctagaaa
attcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtctaag
gcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggccgattcccccgattctgatattattga
back to top
>AF403556.1-matK1515
atggaggaatttcaagtatatttagaactaaatagatcccgccgacacgatttcctatacccacttatttttcgggagta
tatttatgcacttgctcatgagcatggtttaaataaatcgatgattttttttgaaaatcagggttatggtaataaattca
gttcactaattgtgaaacgtttaattcttcgaatggatcaacagaatcgtttgattagttctgctaatgattccaaccaa
aatccggtttttgggcacaacaataatttgtattctcaaatgatagcggtaggatttgcagtcattgtggaaattccatt
ttccttacgattaatatcttactcacaaggggcagaagtcgcaaaatctcataatttacaatcaattcattcaatatttc
cttttttagaggacaaattctcacatttaaattatgtgttagaggcactaatacctcatcccatccatctagaaatctta
gttcaagcccttcgctactgggtaaaagatgcttcttctttgcatttattacggttctctctctacgagtattgtaattt
gaagagttttattactccaaagaaatctatttcgatttttaatccaagattattcttgttcctatataattctcatacat
gtgaatacgaatccattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggggtctttcttgaa
cgaatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaa
agaccctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagt
ggaaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaatta
tctaaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctaga
aaattcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtcta
aggcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggccgattcccccgattctgatattattgac
cgatttgtgcggatatccagaaatctttctcattatcacagtggatcttcaaaaaaaaaaagtttgtatcgaataaaata
tatacttcggttttcttgtgttaaaactttggctcgtaaacacaaaagtactgtccgtgcttttttgaaaaaattaggtt
cggaatttttggaagaattctttacggaaacggaagaagaacatgttttttctttgatcttcccaagaggtttttttgct
atgcgaaaggtctataggggacgaatttggtatttggatattatttgtatcaatgctctggtcaatcattcatga
back to top
>HQ325742.1-matK1515
atggaggaatttcaagtatatttagaactaaatagatcccgccgacacgatttcctatacccacttatttttcgggagta
tatttatgcacttgctcatgagcatggtttaaataaatcgatgattttttttgaaaatcagggttatggtaataaattca
gttcactaattgtgaaacgtttaattcttcgaatggatcaacagaatcgtttgattagttctgctaatgattccaaccaa
aatccggtttttgggcacaacaataatttgtattctcaaatgatagcggtaggatttgcagtcattgtggaaattccatt
ttccttacgattaatatcttactcacaaggggcagaagtcgcaaaatctcataatttacaatcaattcattcaatatttc
cttttttagaggacaaattctcacatttaaattatgtgttagaggcactaatacctcatcccatccatctagaaatctta
gttcaagcccttcgctactgggtaaaagatgcttcttctttgcatttattacggttctctctctacgagtattgtaattt
gaagagttttattactccaaagaaatctatttcgatttttaatccaagattattcttgttcctatataattctcatacat
gtgaatacgaatccattttcctttttctccgtaatcaatcttctcatttacgatcaacatcttctggggtctttcttgaa
cgaatttttttctatggaaaaataaagtatcttggcgaagtcttttataatgattttcagaacaacctatggttgttcaa
agaccctttcatacattttattaggtatcaaggaaagtcaattctggcctcaaaggatacgtctcttctgatcaataagt
ggaaatattactttgtcgatttatggcaatattatttttacctgtggtctcaatcaggaagagtccgtataaatcaatta
tctaaatattctctcgactttctgggctatctttcaagtgtgcgattaaatccttcagtggtacggagtcaaatgctaga
aaattcatttctaatagataatgctgtgaagacgttggatacaagaattccaattatttcgctcattggatcattgtcta
aggcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggccgattcccccgattctgatattattgac
cgatttgtgcggatatccagaaatctttctcattatcacagtggatcttcaaaaaaaaaaagtttgtatcgaataaaata
tatacttcggttttcttgtgttaaaactttggctcgtaaacacaaaagtactgtccgtgcttttttgaaaaaattaggtt
cggaatttttggaagaattctttacggaaacggaagaagaacatgttttttctttgatcttcccaagaggtttttttgct
atgcgaaaggtctataggggacgaatttggtatttggatattatttgtatcaatgctctggtcaatcattcatga
back to top
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
matKNC_023215.1-matKGossypium herbaceumgene
matKJX517350.1-matKGossypium herbaceumgene
matKJN201400.1-matKGossypium herbaceumgene
matKJN201399.1-matKGossypium herbaceumgene
matKJN201398.1-matKGossypium herbaceumgene
matKJN201397.1-matKGossypium herbaceumgene
matKJN201396.1-matKGossypium herbaceumgene
matKJN201395.1-matKGossypium herbaceumgene
matKJN201394.1-matKGossypium herbaceumgene
matKJN201393.1-matKGossypium herbaceumgene
matKJN201392.1-matKGossypium herbaceumgene
matKJN201391.1-matKGossypium herbaceumgene
matKNC_016692.1-matKGossypium herbaceumgene
matKJF270794.1-matKGossypium herbaceumgene
matKJF317353.1-matKGossypium herbaceumgene
matKGU935202.1-matKGossypium herbaceumgene
matKGU935201.1-matKGossypium herbaceumgene
matKGU935200.1-matKGossypium herbaceumgene
matKGU935199.1-matKGossypium herbaceumgene
matKGU935198.1-matKGossypium herbaceumgene
matKGU935197.1-matKGossypium herbaceumgene
matKGU935196.1-matKGossypium herbaceumgene
matKGU935195.1-matKGossypium herbaceumgene
matKGU935194.1-matKGossypium herbaceumgene
matKGU935193.1-matKGossypium herbaceumgene
matKGU935192.1-matKGossypium herbaceumgene
matKGU935191.1-matKGossypium herbaceumgene
matKGU935190.1-matKGossypium herbaceumgene
matKAF403556.1-matKGossypium herbaceumgene
matKHQ325742.1-matKGossypium herbaceumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
matKJF317353.1-matK.m3Gossypium herbaceummRNA
matKGU935202.1-matK.m1Gossypium herbaceummRNA
matKGU935201.1-matK.m1Gossypium herbaceummRNA
matKGU935200.1-matK.m1Gossypium herbaceummRNA
matKGU935199.1-matK.m1Gossypium herbaceummRNA
matKGU935198.1-matK.m1Gossypium herbaceummRNA
matKGU935197.1-matK.m1Gossypium herbaceummRNA
matKGU935196.1-matK.m1Gossypium herbaceummRNA
matKGU935195.1-matK.m1Gossypium herbaceummRNA
matKGU935194.1-matK.m1Gossypium herbaceummRNA
matKGU935193.1-matK.m1Gossypium herbaceummRNA
matKGU935192.1-matK.m1Gossypium herbaceummRNA
matKGU935191.1-matK.m1Gossypium herbaceummRNA
matKGU935190.1-matK.m1Gossypium herbaceummRNA
matKAF403556.1-matK.m1Gossypium herbaceummRNA
matKHQ325742.1-matK.m3Gossypium herbaceummRNA
matKNC_023215.1-matK.m3Gossypium herbaceummRNA
matKJX517350.1-matK.m1Gossypium herbaceummRNA
matKJN201400.1-matK.m1Gossypium herbaceummRNA
matKJN201399.1-matK.m1Gossypium herbaceummRNA
matKJN201398.1-matK.m1Gossypium herbaceummRNA
matKJN201397.1-matK.m1Gossypium herbaceummRNA
matKJN201396.1-matK.m1Gossypium herbaceummRNA
matKJN201395.1-matK.m1Gossypium herbaceummRNA
matKJN201394.1-matK.m1Gossypium herbaceummRNA
matKJN201393.1-matK.m1Gossypium herbaceummRNA
matKJN201392.1-matK.m1Gossypium herbaceummRNA
matKJN201391.1-matK.m1Gossypium herbaceummRNA
matKNC_016692.1-matK.m3Gossypium herbaceummRNA
matKJF270794.1-matK.m1Gossypium herbaceummRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
CottonGen Gene Database2017-09-06