trnK-UUU, trnK-UUU (gene) Gossypium herbaceum

Gene Overview
Name trnK-UUU
Gene Symbol trnK-UUU
Type gene
Organism Gossypium herbaceum
Synonym NA
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Name Genome Location NCBI Accession
NC_023215.1-trnK-UUU N/A NC_023215.1
NC_016692.1-trnK-UUU N/A NC_016692.1
JF317353.1-trnK-UUU N/A JF317353.1
HQ325742.1-trnK-UUU N/A HQ325742.1

Sequence(s):
>NC_023215.1-trnK-UUU2562
gggttgctaactcaacggtagagtactcggcttttaagtgcgactagcatcttttacacatttgtatgaagaaagggatt
cgttcagaccatcggtagagtttgtaagaccacgactgatcctgaaaggagtggatggaaaaaagagcatgtcgtagcaa
tggagaattctaagaatcctttttttccggatcattccaaaaaaaaccgtttttgaatttttggtgcggaacaaaaaaaa
tgaattgaattcaaagttgggtcgagtgaataaatggatagagctctacggccccaattatagggaaacaaaaagtaacg
agcttctgttctcaatttgaatgattacctgatctaattaaacgttaaaaagaaattagtgcctaatgtggtaaaggttt
ttctcatgagtaaattatcgatttttttatgagtccttattattaggcattccctttatgggttagccatgaatgtgtag
aagaagcagtatattgataaagaaaagatatttttttccaaaatcaaaagagcgattgggttgaaaaaataaaggatttc
taaccgtcttcttatcctataacgaacataaatcaattagatggcaaaagataggatagagaatccgttgatgaatccgc
ctgtctccgaggtatctattcttttcttactataataccttgttttgactgtatcgcactatgtatcatttaataaccga
atagatcccctatctttggttcaaatcgaatttgaaatggaggaatttcaagtatatttagaactaaatagatcccgccg
acacgatttcctatacccacttatttttcgggagtatatttatgcacttgctcatgagcatggtttaaataaatcgatga
ttttttttgaaaatcagggttctggtaataaattcagttcactaattgtgaaacgtttaattcttcgaatggatcaacag
aatcgtttgattagttctgctaatgattccaaccaaaatccggtttttggacacaacaataatttgtattctcaaatgat
agcggcaggatttgcagtcattgtggaaattccattttccttacgattaatatcttactcacaaggggcagaagccgcaa
aatctcataattttcaatcaattcattcaatatttccttttttagaggacaaattctcacatttaaattatgtgttagag
gcactaatacctcatcccatccatctagaaatcttagttcaagcccttcgctactgggtaaaagatgcttcttctttgca
tttattacggttctctctctacgagtattgtaatttgaagagttttattactccaaagaaatctatttctatttttaatc
caagattattcttgttcctgtataattctcatacatgtgaatacgaatctattttcctttttctccgtaatcaatcttct
catttacgatcaacatcttctggagtctttcttgaacgaatttttttctatggaaaaataaagtatcttggcgaagtctt
ttataatgattttcagaacaacctatggttgttcaaagaccctttcatacattttattaggtatcaaggaaagtcaattc
tggcctcaaaggatacgtctcttctgatcaataagtggaaatattactttgtcgatttatggcaatattatttttacctg
tggtctcaatcaggaagagtccgtataaatcaattatctaaatattctctcgactttctgggctatctttcaagtgtgcg
attaaatccttcagtggtacggagtcaaatgctagaaaattcatttctaatagataatgctgtgaagacgttggatacaa
gaattccaattatttcgctcattggatcattgtctaaggcgaaattttgtaacacattagggcaccccattagtaagccg
acgtgggccgattcccccgattctgatattattgaccgatttgtgcgtatatccagaaatctttctcattatcacagtgg
atcttcaaaaaaaaaaagtttgtatcgaataaaatatatacttcggttttcttgtgttaaaactttggctcgtaaacaca
aaagtactgtccgtgcttttttgaaaaaattaggttcggaatttttggaagaattctttacggaaacggaagaagaacat
gttttttctttgatcttcccaagaggtttttttgctttgcgaaaggtctataggggacgaatttggtatttggatattat
ttgtatcaatgctctggtcaatcattcatgattggttatgaaattatgtaaattcaattctagtattaaatgttcaggca
gtaagaataagaggggattggccgagtattccgctttttttttagagtcctgtttagggaataaacagggttttagatgg
atacatagagaaagccgtgtgcaatgaaaaatgcaagcacggtttggggagggattttttattctttaacttttaaatta
gtaaattagaatttatttaatttaaacaaggaaattatctactccatccgactagttccgggttcgagtcccgggcaacc
ca
back to top
>NC_016692.1-trnK-UUU2606
gggttgctaactcaacggtagagtactcggcttttaagtgcgactagcatcttttacacatttgtatgaagaaagggatt
cgttcagaccatcggtagagtttgtaagaccacgactgatcctgaaaggaggggatggaaaaaagagcatgtcgtagcaa
tggagaattctaagaatcctttttttccggatcattcccgtttttgaatttttggtgcggaacaaaaaaaatgaattgaa
ttcaaagttgggtcgagtgaataaatggatagagctctacggccccaattatagggaaacaaaaaggaacgagcttctgt
tctcaatttgaatgattacctgatctaattaaacgttaaaaataaattagtgcctaatgtggtaaaggtttttctcatga
gtaaattatcgatttttttatgagtcctaattattaggcattccctttatgggttagccatgaatgtgtagaagaagcag
tatattgataaagaaaagatatttttttccaaaatcaaaagagcgattgggttgaaaaaataaaggatttctaaccgtct
tcttatcctataacgaacataaatcaattagatggcaaaagataggatagagaatccgttgatgaatccgcctgtctccg
aggtatctattcttttcttactataataccttgttttgactgtatcgcactatgtatcatttaataaccgaatagatccc
ctatctttggttcaaatcgaatttgaaatggaggaatttcaagtatatttagaactaaatagatcccgccgacacgattt
cctatacccacttatttttcgggagtatatttatgcacttgctcatgagcatggtttaaataaatcgatgattttttttg
aaaatcagggttatggtaataaattcagttcactaattgtgaaacgtttaattcttcgaatggatcaacagaatcgtttg
attagttctgctaatgattccaaccaaaatccggtttttgggcacaacaataatttgtattctcaaatgatagcggtagg
atttgcagtcattgtggaaattccattttccttacgattaatatcttactcacaaggggcagaagtcgcaaaatctcata
atttacaatcaattcattcaatatttccttttttagaggacaaattctcacatttaaattatgtgttagaggcactaata
cctcatcccatccatctagaaatcttagttcaagcccttcgctactgggtaaaagatgcttcttctttgcatttattacg
gttctctctctacgagtattgtaatttgaagagttttattactccaaagaaatctatttcgatttttaatccaagattat
tcttgttcctatataattctcatacatgtgaatacgaatccattttcctttttctccgtaatcaatcttctcatttacga
tcaacatcttctggggtctttcttgaacgaatttttttctatggaaaaataaagtatcttggcgaagtcttttataatga
ttttcagaacaacctatggttgttcaaagaccctttcatacattttattaggtatcaaggaaagtcaattctggcctcaa
aggatacgtctcttctgatcaataagtggaaatattactttgtcgatttatggcaatattatttttacctgtggtctcaa
tcaggaagagtccgtataaatcaattatctaaatattctctcgactttctgggctatctttcaagtgtgcgattaaatcc
ttcagtggtacggagtcaaatgctagaaaattcatttctaatagataatgctgtgaagacgttggatacaagaattccaa
ttatttcgctcattggatcattgtctaaggcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggcc
gattcccccgattctgatattattgaccgatttgtgcggatatccagaaatctttctcattatcacagtggatcttcaaa
aaaaaaaagtttgtatcgaataaaatatatacttcggttttcttgtgttaaaactttggctcgtaaacacaaaagtactg
tccgtgcttttttgaaaaaattaggttcggaatttttggaagaattctttacggaaacggaagaagaacatgttttttct
ttgatcttcccaagaggtttttttgctatgcgaaaggtctataggggacgaatttggtatttggatattatttgtatcaa
tgctctggtcaatcattcatgattggttatgaaattatgtaaattcaattatcaattacaataaaaatggtaattttacg
aaatgatgaagagataacaaacgaatttattcatttctagtattaaatgttcaggcagtaagaataagaggggattggcc
gagtattccgctttttttttagagtcctgtttagggaataaacagggttttagatggatacatagagaaagccgtgtgca
atgaaaaatgcaagcacggtttggggagggattttttttttcttttaaatttcaatttatttaattgaaacaaggaaatt
atctactccatccgactagttccgggttcgagtcccgggcaaccca
back to top
>JF317353.1-trnK-UUU2562
gggttgctaactcaacggtagagtactcggcttttaagtgcgactagcatcttttacacatttgtatgaagaaagggatt
cgttcagaccatcggtagagtttgtaagaccacgactgatcctgaaaggagtggatggaaaaaagagcatgtcgtagcaa
tggagaattctaagaatcctttttttccggatcattccaaaaaaaaccgtttttgaatttttggtgcggaacaaaaaaaa
tgaattgaattcaaagttgggtcgagtgaataaatggatagagctctacggccccaattatagggaaacaaaaagtaacg
agcttctgttctcaatttgaatgattacctgatctaattaaacgttaaaaagaaattagtgcctaatgtggtaaaggttt
ttctcatgagtaaattatcgatttttttatgagtccttattattaggcattccctttatgggttagccatgaatgtgtag
aagaagcagtatattgataaagaaaagatatttttttccaaaatcaaaagagcgattgggttgaaaaaataaaggatttc
taaccgtcttcttatcctataacgaacataaatcaattagatggcaaaagataggatagagaatccgttgatgaatccgc
ctgtctccgaggtatctattcttttcttactataataccttgttttgactgtatcgcactatgtatcatttaataaccga
atagatcccctatctttggttcaaatcgaatttgaaatggaggaatttcaagtatatttagaactaaatagatcccgccg
acacgatttcctatacccacttatttttcgggagtatatttatgcacttgctcatgagcatggtttaaataaatcgatga
ttttttttgaaaatcagggttctggtaataaattcagttcactaattgtgaaacgtttaattcttcgaatggatcaacag
aatcgtttgattagttctgctaatgattccaaccaaaatccggtttttggacacaacaataatttgtattctcaaatgat
agcggcaggatttgcagtcattgtggaaattccattttccttacgattaatatcttactcacaaggggcagaagccgcaa
aatctcataattttcaatcaattcattcaatatttccttttttagaggacaaattctcacatttaaattatgtgttagag
gcactaatacctcatcccatccatctagaaatcttagttcaagcccttcgctactgggtaaaagatgcttcttctttgca
tttattacggttctctctctacgagtattgtaatttgaagagttttattactccaaagaaatctatttctatttttaatc
caagattattcttgttcctgtataattctcatacatgtgaatacgaatctattttcctttttctccgtaatcaatcttct
catttacgatcaacatcttctggagtctttcttgaacgaatttttttctatggaaaaataaagtatcttggcgaagtctt
ttataatgattttcagaacaacctatggttgttcaaagaccctttcatacattttattaggtatcaaggaaagtcaattc
tggcctcaaaggatacgtctcttctgatcaataagtggaaatattactttgtcgatttatggcaatattatttttacctg
tggtctcaatcaggaagagtccgtataaatcaattatctaaatattctctcgactttctgggctatctttcaagtgtgcg
attaaatccttcagtggtacggagtcaaatgctagaaaattcatttctaatagataatgctgtgaagacgttggatacaa
gaattccaattatttcgctcattggatcattgtctaaggcgaaattttgtaacacattagggcaccccattagtaagccg
acgtgggccgattcccccgattctgatattattgaccgatttgtgcgtatatccagaaatctttctcattatcacagtgg
atcttcaaaaaaaaaaagtttgtatcgaataaaatatatacttcggttttcttgtgttaaaactttggctcgtaaacaca
aaagtactgtccgtgcttttttgaaaaaattaggttcggaatttttggaagaattctttacggaaacggaagaagaacat
gttttttctttgatcttcccaagaggtttttttgctttgcgaaaggtctataggggacgaatttggtatttggatattat
ttgtatcaatgctctggtcaatcattcatgattggttatgaaattatgtaaattcaattctagtattaaatgttcaggca
gtaagaataagaggggattggccgagtattccgctttttttttagagtcctgtttagggaataaacagggttttagatgg
atacatagagaaagccgtgtgcaatgaaaaatgcaagcacggtttggggagggattttttattctttaacttttaaatta
gtaaattagaatttatttaatttaaacaaggaaattatctactccatccgactagttccgggttcgagtcccgggcaacc
ca
back to top
>HQ325742.1-trnK-UUU2606
gggttgctaactcaacggtagagtactcggcttttaagtgcgactagcatcttttacacatttgtatgaagaaagggatt
cgttcagaccatcggtagagtttgtaagaccacgactgatcctgaaaggaggggatggaaaaaagagcatgtcgtagcaa
tggagaattctaagaatcctttttttccggatcattcccgtttttgaatttttggtgcggaacaaaaaaaatgaattgaa
ttcaaagttgggtcgagtgaataaatggatagagctctacggccccaattatagggaaacaaaaaggaacgagcttctgt
tctcaatttgaatgattacctgatctaattaaacgttaaaaataaattagtgcctaatgtggtaaaggtttttctcatga
gtaaattatcgatttttttatgagtcctaattattaggcattccctttatgggttagccatgaatgtgtagaagaagcag
tatattgataaagaaaagatatttttttccaaaatcaaaagagcgattgggttgaaaaaataaaggatttctaaccgtct
tcttatcctataacgaacataaatcaattagatggcaaaagataggatagagaatccgttgatgaatccgcctgtctccg
aggtatctattcttttcttactataataccttgttttgactgtatcgcactatgtatcatttaataaccgaatagatccc
ctatctttggttcaaatcgaatttgaaatggaggaatttcaagtatatttagaactaaatagatcccgccgacacgattt
cctatacccacttatttttcgggagtatatttatgcacttgctcatgagcatggtttaaataaatcgatgattttttttg
aaaatcagggttatggtaataaattcagttcactaattgtgaaacgtttaattcttcgaatggatcaacagaatcgtttg
attagttctgctaatgattccaaccaaaatccggtttttgggcacaacaataatttgtattctcaaatgatagcggtagg
atttgcagtcattgtggaaattccattttccttacgattaatatcttactcacaaggggcagaagtcgcaaaatctcata
atttacaatcaattcattcaatatttccttttttagaggacaaattctcacatttaaattatgtgttagaggcactaata
cctcatcccatccatctagaaatcttagttcaagcccttcgctactgggtaaaagatgcttcttctttgcatttattacg
gttctctctctacgagtattgtaatttgaagagttttattactccaaagaaatctatttcgatttttaatccaagattat
tcttgttcctatataattctcatacatgtgaatacgaatccattttcctttttctccgtaatcaatcttctcatttacga
tcaacatcttctggggtctttcttgaacgaatttttttctatggaaaaataaagtatcttggcgaagtcttttataatga
ttttcagaacaacctatggttgttcaaagaccctttcatacattttattaggtatcaaggaaagtcaattctggcctcaa
aggatacgtctcttctgatcaataagtggaaatattactttgtcgatttatggcaatattatttttacctgtggtctcaa
tcaggaagagtccgtataaatcaattatctaaatattctctcgactttctgggctatctttcaagtgtgcgattaaatcc
ttcagtggtacggagtcaaatgctagaaaattcatttctaatagataatgctgtgaagacgttggatacaagaattccaa
ttatttcgctcattggatcattgtctaaggcgaaattttgtaacacattagggcatcccattagtaagccgacgtgggcc
gattcccccgattctgatattattgaccgatttgtgcggatatccagaaatctttctcattatcacagtggatcttcaaa
aaaaaaaagtttgtatcgaataaaatatatacttcggttttcttgtgttaaaactttggctcgtaaacacaaaagtactg
tccgtgcttttttgaaaaaattaggttcggaatttttggaagaattctttacggaaacggaagaagaacatgttttttct
ttgatcttcccaagaggtttttttgctatgcgaaaggtctataggggacgaatttggtatttggatattatttgtatcaa
tgctctggtcaatcattcatgattggttatgaaattatgtaaattcaattatcaattacaataaaaatggtaattttacg
aaatgatgaagagataacaaacgaatttattcatttctagtattaaatgttcaggcagtaagaataagaggggattggcc
gagtattccgctttttttttagagtcctgtttagggaataaacagggttttagatggatacatagagaaagccgtgtgca
atgaaaaatgcaagcacggtttggggagggattttttttttcttttaaatttcaatttatttaattgaaacaaggaaatt
atctactccatccgactagttccgggttcgagtcccgggcaaccca
back to top
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
trnK-UUUNC_023215.1-trnK-UUUGossypium herbaceumgene
trnK-UUUNC_016692.1-trnK-UUUGossypium herbaceumgene
trnK-UUUJF317353.1-trnK-UUUGossypium herbaceumgene
trnK-UUUHQ325742.1-trnK-UUUGossypium herbaceumgene


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
CottonGen Gene Database2017-09-06