psbA, psbA (gene) Gossypium herbaceum

Gene Overview
Name psbA
Gene Symbol psbA
Type gene
Organism Gossypium herbaceum
Synonym photosystem II protein D1
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Name Genome Location NCBI Accession
NC_023215.1-psbA N/A NC_023215.1
NC_016692.1-psbA N/A NC_016692.1
JF317353.1-psbA.m2 N/A JF317353.1
HM437900.1-psbA.m1 N/A HM437900.1
HM437899.1-psbA.m1 N/A HM437899.1
HM437898.1-psbA.m1 N/A HM437898.1
HM437897.1-psbA.m1 N/A HM437897.1
HM437896.1-psbA.m1 N/A HM437896.1
HM437895.1-psbA.m1 N/A HM437895.1
HM437894.1-psbA.m1 N/A HM437894.1
HM437893.1-psbA.m1 N/A HM437893.1
HM437892.1-psbA.m1 N/A HM437892.1
HM437891.1-psbA.m1 N/A HM437891.1
HM437890.1-psbA.m1 N/A HM437890.1
HM437889.1-psbA.m1 N/A HM437889.1
HM437888.1-psbA.m1 N/A HM437888.1
HM437887.1-psbA.m1 N/A HM437887.1
HM437886.1-psbA.m1 N/A HM437886.1
HQ325742.1-psbA.m2 N/A HQ325742.1
NC_023215.1-psbA.m2 N/A NC_023215.1
NC_016692.1-psbA.m2 N/A NC_016692.1
JF317353.1-psbA N/A JF317353.1
HM437900.1-psbA N/A HM437900.1
HM437899.1-psbA N/A HM437899.1
HM437898.1-psbA N/A HM437898.1
HM437897.1-psbA N/A HM437897.1
HM437896.1-psbA N/A HM437896.1
HM437895.1-psbA N/A HM437895.1
HM437894.1-psbA N/A HM437894.1
HM437893.1-psbA N/A HM437893.1
HM437892.1-psbA N/A HM437892.1
HM437891.1-psbA N/A HM437891.1
HM437890.1-psbA N/A HM437890.1
HM437889.1-psbA N/A HM437889.1
HM437888.1-psbA N/A HM437888.1
HM437887.1-psbA N/A HM437887.1
HM437886.1-psbA N/A HM437886.1
HQ325742.1-psbA N/A HQ325742.1

Sequence(s):
>NC_023215.1-psbA1062
atgactgcaattttagagagacgcgaaagcgaaagcctatggggtcgcttctgtaactggataaccagcactgaaaaccg
tctttacatcggatggtttggtgttttgatgatccctaccttattgaccgcaacttctgtatttattatcgccttcattg
ctgctcctccagtagatattgatggtattcgtgaacctgtttctggatctctactttacggaaacaatattatttctggt
gccattattcctacttctgcagctataggtttgcacttttacccgatctgggaagcggcatctgttgatgaatggttata
caatggcggtccttatgagttaattgttttacacttcttacttggtgtagcttgttacatgggtcgtgagtgggaactta
gtttccgtctgggtatgcgcccttggatcgctgttgcatattcagctcctgttgcagctgctaccgctgttttcttgatc
tatccaattggtcaaggaagtttttctgatggtatgcccctaggaatctctggaactttcaacttcatgattgtattcca
ggctgaacacaacatccttatgcatccgtttcacatgttaggcgtagctggtgtattcggcggctccctattcagtgcta
tgcatggttccttggtaacctctagtttgatcagggaaaccacagaaaatgaatctgctaatgaaggttacagattcggt
caagaggaagaaacttataatatcgtagctgctcatggttattttggccgattgatcttccaatatgctagtttcaacaa
ttctcgttctttacatttcttcttagctgcttggcctgtagtaggtatctggttcaccgctttaggtattagcactatgg
ctttcaacctaaacggtttcaattttaaccaatctgtagttgatagtcaaggtcgtgtaattaatacctgggctgatatt
attaaccgtgctaaccttggtatggaagttatgcatgaacgtaatgctcataacttccctctagacctagctgctattga
agctccatctacaaatggataa
back to top
>NC_016692.1-psbA1062
atgactgcaattttagagagacgcgaaagcgaaagcctatggggtcgcttctgtaactggataactagcactgaaaaccg
tctttacatcggatggtttggtgttttgatgatccctaccttattgaccgcaacttctgtatttattatcgccttcattg
ctgctcctccagtagatattgatggtattcgtgaacctgtttctggatctctactttacggaaacaatattatttctggt
gccattattcctacttctgcagctataggtttgcacttttacccgatctgggaagcggcatctgttgatgaatggttata
caatggcggtccttatgagttaattgttttacacttcttacttggtgtagcttgttacatgggtcgtgagtgggaactta
gtttccgtctgggtatgcgcccttggatcgctgttgcatattcagctcctgttgcagctgctaccgctgttttcttgatc
tatccaattggtcaaggaagtttttctgatggtatgcccctaggaatctctggtactttcaacttcatgattgtattcca
ggctgaacacaacatccttatgcatccgtttcacatgttaggcgtagctggtgtattcggcggctccctattcagtgcta
tgcatggttccttggtaacctctagtttgatcagggaaaccacagaaaatgaatctgctaatgaaggttacagattcggt
caagaggaagaaacttataatatcgtagctgctcatggttattttggccgattgatcttccaatatgctagtttcaacaa
ttctcgttctttacatttcttcttagctgcttggcctgtagtaggtatctggttcaccgctttaggtattagcactatgg
ctttcaacctaaacggtttcaattttaaccaatccgtagttgatagtcaaggtcgtgtaattaatacctgggctgatatt
attaaccgtgctaaccttggtatggaagttatgcatgaacgtaatgctcataacttccctctagacctagctgctattga
agctccatctacaaatggataa
back to top
>JF317353.1-psbA.m21062
atgactgcaattttagagagacgcgaaagcgaaagcctatggggtcgcttctgtaactggataaccagcactgaaaaccg
tctttacatcggatggtttggtgttttgatgatccctaccttattgaccgcaacttctgtatttattatcgccttcattg
ctgctcctccagtagatattgatggtattcgtgaacctgtttctggatctctactttacggaaacaatattatttctggt
gccattattcctacttctgcagctataggtttgcacttttacccgatctgggaagcggcatctgttgatgaatggttata
caatggcggtccttatgagttaattgttttacacttcttacttggtgtagcttgttacatgggtcgtgagtgggaactta
gtttccgtctgggtatgcgcccttggatcgctgttgcatattcagctcctgttgcagctgctaccgctgttttcttgatc
tatccaattggtcaaggaagtttttctgatggtatgcccctaggaatctctggaactttcaacttcatgattgtattcca
ggctgaacacaacatccttatgcatccgtttcacatgttaggcgtagctggtgtattcggcggctccctattcagtgcta
tgcatggttccttggtaacctctagtttgatcagggaaaccacagaaaatgaatctgctaatgaaggttacagattcggt
caagaggaagaaacttataatatcgtagctgctcatggttattttggccgattgatcttccaatatgctagtttcaacaa
ttctcgttctttacatttcttcttagctgcttggcctgtagtaggtatctggttcaccgctttaggtattagcactatgg
ctttcaacctaaacggtttcaattttaaccaatctgtagttgatagtcaaggtcgtgtaattaatacctgggctgatatt
attaaccgtgctaaccttggtatggaagttatgcatgaacgtaatgctcataacttccctctagacctagctgctattga
agctccatctacaaatggataa
back to top
>HM437900.1-psbA.m165
aacgtaatgctcataacttccctctagacctagctgctattgaagctccatctacaaatggataa
back to top
>HM437899.1-psbA.m165
aacgtaatgctcataacttccctctagacctagctgctattgaagctccatctacaaatggataa
back to top
>HM437898.1-psbA.m158
tgctcataacttccctctagacctagctgctattgaagctccatctacaaatggataa
back to top
>HM437897.1-psbA.m173
tatgcatgaacgtaatgctcataacttccctctagacctagctgctattgaagctccatctacaaatggataa
back to top
>HM437896.1-psbA.m170
gcatgaacgtaatgctcataacttccctctagacctagctgctattgaagctccatctacaaatggataa
back to top
>HM437895.1-psbA.m165
aacgtaatgctcataacttccctctagacctagctgctattgaagctccatctacaaatggataa
back to top
>HM437894.1-psbA.m165
aacgtaatgctcataacttccctctagacctagctgctattgaagctccatctacaaatggataa
back to top
>HM437893.1-psbA.m172
atgcatgaacgtaatgctcataacttccctctagacctagctgctattgaagctccatctacaaatggataa
back to top
>HM437892.1-psbA.m173
tatgcatgaacgtaatgctcataacttccctctagacctagctgctattgaagctccatctacaaatggataa
back to top
>HM437891.1-psbA.m165
aacgtaatgctcataacttccctctagacctagctgctattgaagctccatctacaaatggataa
back to top
>HM437890.1-psbA.m167
tgaacgtaatgctcataacttccctctagacctagctgctattgaagctccatctacaaatggataa
back to top
>HM437889.1-psbA.m172
atgcatgaacgtaatgctcataacttccctctagacctagctgctattgaagctccatctacaaatggataa
back to top
>HM437888.1-psbA.m174
ttatgcatgaacgtaatgctcataacttccctctagacctagctgctattgaagctccatctacaaatggataa
back to top
>HM437887.1-psbA.m172
atgcatgaacgtaatgctcataacttccctctagacctagctgctattgaagctccatctacaaatggataa
back to top
>HM437886.1-psbA.m165
aacgtaatgctcataacttccctctagacctagctgctattgaagctccatctacaaatggataa
back to top
>HQ325742.1-psbA.m21062
atgactgcaattttagagagacgcgaaagcgaaagcctatggggtcgcttctgtaactggataactagcactgaaaaccg
tctttacatcggatggtttggtgttttgatgatccctaccttattgaccgcaacttctgtatttattatcgccttcattg
ctgctcctccagtagatattgatggtattcgtgaacctgtttctggatctctactttacggaaacaatattatttctggt
gccattattcctacttctgcagctataggtttgcacttttacccgatctgggaagcggcatctgttgatgaatggttata
caatggcggtccttatgagttaattgttttacacttcttacttggtgtagcttgttacatgggtcgtgagtgggaactta
gtttccgtctgggtatgcgcccttggatcgctgttgcatattcagctcctgttgcagctgctaccgctgttttcttgatc
tatccaattggtcaaggaagtttttctgatggtatgcccctaggaatctctggtactttcaacttcatgattgtattcca
ggctgaacacaacatccttatgcatccgtttcacatgttaggcgtagctggtgtattcggcggctccctattcagtgcta
tgcatggttccttggtaacctctagtttgatcagggaaaccacagaaaatgaatctgctaatgaaggttacagattcggt
caagaggaagaaacttataatatcgtagctgctcatggttattttggccgattgatcttccaatatgctagtttcaacaa
ttctcgttctttacatttcttcttagctgcttggcctgtagtaggtatctggttcaccgctttaggtattagcactatgg
ctttcaacctaaacggtttcaattttaaccaatccgtagttgatagtcaaggtcgtgtaattaatacctgggctgatatt
attaaccgtgctaaccttggtatggaagttatgcatgaacgtaatgctcataacttccctctagacctagctgctattga
agctccatctacaaatggataa
back to top
>NC_023215.1-psbA.m21062
atgactgcaattttagagagacgcgaaagcgaaagcctatggggtcgcttctgtaactggataaccagcactgaaaaccg
tctttacatcggatggtttggtgttttgatgatccctaccttattgaccgcaacttctgtatttattatcgccttcattg
ctgctcctccagtagatattgatggtattcgtgaacctgtttctggatctctactttacggaaacaatattatttctggt
gccattattcctacttctgcagctataggtttgcacttttacccgatctgggaagcggcatctgttgatgaatggttata
caatggcggtccttatgagttaattgttttacacttcttacttggtgtagcttgttacatgggtcgtgagtgggaactta
gtttccgtctgggtatgcgcccttggatcgctgttgcatattcagctcctgttgcagctgctaccgctgttttcttgatc
tatccaattggtcaaggaagtttttctgatggtatgcccctaggaatctctggaactttcaacttcatgattgtattcca
ggctgaacacaacatccttatgcatccgtttcacatgttaggcgtagctggtgtattcggcggctccctattcagtgcta
tgcatggttccttggtaacctctagtttgatcagggaaaccacagaaaatgaatctgctaatgaaggttacagattcggt
caagaggaagaaacttataatatcgtagctgctcatggttattttggccgattgatcttccaatatgctagtttcaacaa
ttctcgttctttacatttcttcttagctgcttggcctgtagtaggtatctggttcaccgctttaggtattagcactatgg
ctttcaacctaaacggtttcaattttaaccaatctgtagttgatagtcaaggtcgtgtaattaatacctgggctgatatt
attaaccgtgctaaccttggtatggaagttatgcatgaacgtaatgctcataacttccctctagacctagctgctattga
agctccatctacaaatggataa
back to top
>NC_016692.1-psbA.m21062
atgactgcaattttagagagacgcgaaagcgaaagcctatggggtcgcttctgtaactggataactagcactgaaaaccg
tctttacatcggatggtttggtgttttgatgatccctaccttattgaccgcaacttctgtatttattatcgccttcattg
ctgctcctccagtagatattgatggtattcgtgaacctgtttctggatctctactttacggaaacaatattatttctggt
gccattattcctacttctgcagctataggtttgcacttttacccgatctgggaagcggcatctgttgatgaatggttata
caatggcggtccttatgagttaattgttttacacttcttacttggtgtagcttgttacatgggtcgtgagtgggaactta
gtttccgtctgggtatgcgcccttggatcgctgttgcatattcagctcctgttgcagctgctaccgctgttttcttgatc
tatccaattggtcaaggaagtttttctgatggtatgcccctaggaatctctggtactttcaacttcatgattgtattcca
ggctgaacacaacatccttatgcatccgtttcacatgttaggcgtagctggtgtattcggcggctccctattcagtgcta
tgcatggttccttggtaacctctagtttgatcagggaaaccacagaaaatgaatctgctaatgaaggttacagattcggt
caagaggaagaaacttataatatcgtagctgctcatggttattttggccgattgatcttccaatatgctagtttcaacaa
ttctcgttctttacatttcttcttagctgcttggcctgtagtaggtatctggttcaccgctttaggtattagcactatgg
ctttcaacctaaacggtttcaattttaaccaatccgtagttgatagtcaaggtcgtgtaattaatacctgggctgatatt
attaaccgtgctaaccttggtatggaagttatgcatgaacgtaatgctcataacttccctctagacctagctgctattga
agctccatctacaaatggataa
back to top
>JF317353.1-psbA1062
atgactgcaattttagagagacgcgaaagcgaaagcctatggggtcgcttctgtaactggataaccagcactgaaaaccg
tctttacatcggatggtttggtgttttgatgatccctaccttattgaccgcaacttctgtatttattatcgccttcattg
ctgctcctccagtagatattgatggtattcgtgaacctgtttctggatctctactttacggaaacaatattatttctggt
gccattattcctacttctgcagctataggtttgcacttttacccgatctgggaagcggcatctgttgatgaatggttata
caatggcggtccttatgagttaattgttttacacttcttacttggtgtagcttgttacatgggtcgtgagtgggaactta
gtttccgtctgggtatgcgcccttggatcgctgttgcatattcagctcctgttgcagctgctaccgctgttttcttgatc
tatccaattggtcaaggaagtttttctgatggtatgcccctaggaatctctggaactttcaacttcatgattgtattcca
ggctgaacacaacatccttatgcatccgtttcacatgttaggcgtagctggtgtattcggcggctccctattcagtgcta
tgcatggttccttggtaacctctagtttgatcagggaaaccacagaaaatgaatctgctaatgaaggttacagattcggt
caagaggaagaaacttataatatcgtagctgctcatggttattttggccgattgatcttccaatatgctagtttcaacaa
ttctcgttctttacatttcttcttagctgcttggcctgtagtaggtatctggttcaccgctttaggtattagcactatgg
ctttcaacctaaacggtttcaattttaaccaatctgtagttgatagtcaaggtcgtgtaattaatacctgggctgatatt
attaaccgtgctaaccttggtatggaagttatgcatgaacgtaatgctcataacttccctctagacctagctgctattga
agctccatctacaaatggataa
back to top
>HM437900.1-psbA65
aacgtaatgctcataacttccctctagacctagctgctattgaagctccatctacaaatggataa
back to top
>HM437899.1-psbA65
aacgtaatgctcataacttccctctagacctagctgctattgaagctccatctacaaatggataa
back to top
>HM437898.1-psbA58
tgctcataacttccctctagacctagctgctattgaagctccatctacaaatggataa
back to top
>HM437897.1-psbA73
tatgcatgaacgtaatgctcataacttccctctagacctagctgctattgaagctccatctacaaatggataa
back to top
>HM437896.1-psbA70
gcatgaacgtaatgctcataacttccctctagacctagctgctattgaagctccatctacaaatggataa
back to top
>HM437895.1-psbA65
aacgtaatgctcataacttccctctagacctagctgctattgaagctccatctacaaatggataa
back to top
>HM437894.1-psbA65
aacgtaatgctcataacttccctctagacctagctgctattgaagctccatctacaaatggataa
back to top
>HM437893.1-psbA72
atgcatgaacgtaatgctcataacttccctctagacctagctgctattgaagctccatctacaaatggataa
back to top
>HM437892.1-psbA73
tatgcatgaacgtaatgctcataacttccctctagacctagctgctattgaagctccatctacaaatggataa
back to top
>HM437891.1-psbA65
aacgtaatgctcataacttccctctagacctagctgctattgaagctccatctacaaatggataa
back to top
>HM437890.1-psbA67
tgaacgtaatgctcataacttccctctagacctagctgctattgaagctccatctacaaatggataa
back to top
>HM437889.1-psbA72
atgcatgaacgtaatgctcataacttccctctagacctagctgctattgaagctccatctacaaatggataa
back to top
>HM437888.1-psbA74
ttatgcatgaacgtaatgctcataacttccctctagacctagctgctattgaagctccatctacaaatggataa
back to top
>HM437887.1-psbA72
atgcatgaacgtaatgctcataacttccctctagacctagctgctattgaagctccatctacaaatggataa
back to top
>HM437886.1-psbA65
aacgtaatgctcataacttccctctagacctagctgctattgaagctccatctacaaatggataa
back to top
>HQ325742.1-psbA1062
atgactgcaattttagagagacgcgaaagcgaaagcctatggggtcgcttctgtaactggataactagcactgaaaaccg
tctttacatcggatggtttggtgttttgatgatccctaccttattgaccgcaacttctgtatttattatcgccttcattg
ctgctcctccagtagatattgatggtattcgtgaacctgtttctggatctctactttacggaaacaatattatttctggt
gccattattcctacttctgcagctataggtttgcacttttacccgatctgggaagcggcatctgttgatgaatggttata
caatggcggtccttatgagttaattgttttacacttcttacttggtgtagcttgttacatgggtcgtgagtgggaactta
gtttccgtctgggtatgcgcccttggatcgctgttgcatattcagctcctgttgcagctgctaccgctgttttcttgatc
tatccaattggtcaaggaagtttttctgatggtatgcccctaggaatctctggtactttcaacttcatgattgtattcca
ggctgaacacaacatccttatgcatccgtttcacatgttaggcgtagctggtgtattcggcggctccctattcagtgcta
tgcatggttccttggtaacctctagtttgatcagggaaaccacagaaaatgaatctgctaatgaaggttacagattcggt
caagaggaagaaacttataatatcgtagctgctcatggttattttggccgattgatcttccaatatgctagtttcaacaa
ttctcgttctttacatttcttcttagctgcttggcctgtagtaggtatctggttcaccgctttaggtattagcactatgg
ctttcaacctaaacggtttcaattttaaccaatccgtagttgatagtcaaggtcgtgtaattaatacctgggctgatatt
attaaccgtgctaaccttggtatggaagttatgcatgaacgtaatgctcataacttccctctagacctagctgctattga
agctccatctacaaatggataa
back to top
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
psbANC_023215.1-psbAGossypium herbaceumgene
psbANC_016692.1-psbAGossypium herbaceumgene
psbAJF317353.1-psbAGossypium herbaceumgene
psbAHM437900.1-psbAGossypium herbaceumgene
psbAHM437899.1-psbAGossypium herbaceumgene
psbAHM437898.1-psbAGossypium herbaceumgene
psbAHM437897.1-psbAGossypium herbaceumgene
psbAHM437896.1-psbAGossypium herbaceumgene
psbAHM437895.1-psbAGossypium herbaceumgene
psbAHM437894.1-psbAGossypium herbaceumgene
psbAHM437893.1-psbAGossypium herbaceumgene
psbAHM437892.1-psbAGossypium herbaceumgene
psbAHM437891.1-psbAGossypium herbaceumgene
psbAHM437890.1-psbAGossypium herbaceumgene
psbAHM437889.1-psbAGossypium herbaceumgene
psbAHM437888.1-psbAGossypium herbaceumgene
psbAHM437887.1-psbAGossypium herbaceumgene
psbAHM437886.1-psbAGossypium herbaceumgene
psbAHQ325742.1-psbAGossypium herbaceumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
psbAJF317353.1-psbA.m2Gossypium herbaceummRNA
psbAHM437900.1-psbA.m1Gossypium herbaceummRNA
psbAHM437899.1-psbA.m1Gossypium herbaceummRNA
psbAHM437898.1-psbA.m1Gossypium herbaceummRNA
psbAHM437897.1-psbA.m1Gossypium herbaceummRNA
psbAHM437896.1-psbA.m1Gossypium herbaceummRNA
psbAHM437895.1-psbA.m1Gossypium herbaceummRNA
psbAHM437894.1-psbA.m1Gossypium herbaceummRNA
psbAHM437893.1-psbA.m1Gossypium herbaceummRNA
psbAHM437892.1-psbA.m1Gossypium herbaceummRNA
psbAHM437891.1-psbA.m1Gossypium herbaceummRNA
psbAHM437890.1-psbA.m1Gossypium herbaceummRNA
psbAHM437889.1-psbA.m1Gossypium herbaceummRNA
psbAHM437888.1-psbA.m1Gossypium herbaceummRNA
psbAHM437887.1-psbA.m1Gossypium herbaceummRNA
psbAHM437886.1-psbA.m1Gossypium herbaceummRNA
psbAHQ325742.1-psbA.m2Gossypium herbaceummRNA
psbANC_023215.1-psbA.m2Gossypium herbaceummRNA
psbANC_016692.1-psbA.m2Gossypium herbaceummRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
CottonGen Gene Database2017-09-06