rpoB, rpoB (gene) Gossypium areysianum

Gene Overview
Name rpoB
Gene Symbol rpoB
Type gene
Organism Gossypium areysianum
Synonym RNA polymerase beta subunit
Description NA
Comment RNA polymerase beta chain; one of four subunits of~the minimal PEP RNA polymerase catalytic core
Evidence for the gene structure imported from NCBI
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Name Genome Location NCBI Accession
JN019795.1-rpoB N/A JN019795.1
NC_018112.1-rpoB.m14 N/A NC_018112.1
JN019795.1-rpoB.m14 N/A JN019795.1
NC_018112.1-rpoB N/A NC_018112.1

Sequence(s):
>JN019795.1-rpoB3213
atgctcggggatgaaaatggggaaatgtctacaatacctgggttgaatcagatacaatttgaaggattttgtgggttcat
ggatcggggcttaacagaagaactttataagtttccaaaaattgaagatacagagcaagaaattgaatttcaattatttg
tggaaacatatcaattggtggaaccgttgataaaagaaagggatgctgtatatgaatcactcacatattcttctgaatta
tatgtatccgcaggattaatttggaaaaccagtaaggatatgcaagaacaaacaatttttattggaaacattcctttaat
gaactccctcggaacttctatagtaaatggaatatacagaattgtgatcaatcaaatattgcaaagccccggtatctatt
atcgatcagaattggatcataacggaatttcggtctatactggtaccataatatcagattggggagggaggttagaatta
gagattgatagaaaagcaaggatatgggctcgtgtaagtaggaaacagaaaatatctattctagttctatcatcagctat
gggttcgaatctaagagaaattctagagaatgtttgctaccctgagattttcttgtctttcctgaccgataaggaaaaaa
aaaaaattgggtcaaaagaaaatgccattttggagttttatcaacaattttcttgtgtaggcggggatccggtattttct
gaatccttgtgtaaggaattacaaaagaaattctttcagcaaagatgtgaattaggaaggattggtcgacgaaatatgaa
ccagagattgaatcttaatatacctcagaacaatacatttttgttaccgcgagatatattggcagctgcggatcgtttga
ttggaatgaaatttggaatgggtacacttgacgatatgaatcatttgaaaaataagcgtattcgttctgtagcggatctc
ttacaagatcaattcggattggctctggttcgtttagaaaatgtagttagaggaactatatgcggagcaattaggcataa
attgataccgactcctcagaatttggtaacttcgactccattaacaaccacttatgaatcctttttcggattacacccat
tgtctcaagttttggatcgaacaaatccattgacacaaatagtgcatgggagaaaattgagttatttgggccccggagga
ttgaccgggcgaactgctaattttcggatacgagatatccatcctagtcactatggacgcatttgcccaattgacacgtc
tgaagggatcaatgttggacttatcggatccttagcaattcatgccaggattggtcattgggggtctctagaaagtccat
tttataaaatctttgagagatcaaaaaaagcacagatgctttatttatccccccgtcgagatgaatattatatggtagcg
gcaggaaattctttggccttgaatcagggtattcaggaagaacaggttgttccggctcgataccgccaagaattcctgac
tattgcatgggaacaagttcatcttcgaagtatttttccttttcaatatttttcgattggagcttccctcattcctttta
tcgagcataatgacgcgaatcgggctttaatgagttctaatatgcaacgccaagcagttccgctttctcgttccgagaag
tgcattgttggaactgggttggaacgccaagtggctctagattcaggagttcccgctatagccgatcacgagggaaagat
catttctaccgatactgacaagattattttatcgagcaatggagatgctctaggcattccattagttatgtatcaacgtt
ccaacaaaaatacttgtatgcatcaaactgcccgggttcggcggggtaaatgcattaaaaaggggcaaattttagcggac
ggtgccgctacggttggtggcgaactcgctttgggcaaaaacgtactagtagcttatatgccatgggaaggttacaattt
tgaggatgcggtactcattagcgagcgtctagtatatgaagatatttatacttcttttcacatacgaaaatatgaaattc
agactcatgtgacaagccaaggtcctgaaagaatcactaacgaaataccgcacctagaagcccatttactccgcaattta
gacaaaaatggaattgtgatgctgggatcttgggtggagacaggcgatattttagtaggtaaattaacgcctcaggtggc
gaaagaatcatcgtatgctccagaagatagattattacgggccatacttgggattcaggtatccacttcaaaggaaactt
gtctaaaattacctataggtgggaggggtcgagtcatcgatgtgagatgggtccagaaaaaagggggttctagttataat
ccggaaacgattcgtgtatatatttcacagaaacgcgaaatcaaagtaggcgataaagtagccggaaggcatggaaataa
agggatcatttcaaaaattttacctagacaggatatgccttatttgcaagacggaagacctgttgatatggtcttcaacc
cattaggagtaccttcacgaatgaatgtaggacagctatttgaatgctcgcttgggttagcagggagtctactagataga
cattatcgaatagcaccatttgatgagagatatgaacaagaggcttcgagaaaactagtgttttccgaattatatcaagc
cagtaagcaaacagcgaatccatgggtatttgaacccgaatatccaggaaaaagcagaatatttgatggaagaacgggag
gcccctttgagcaacctgttataataggaaaaccttatatcttgaaattaattcatcaagttgatgataaaatacatggg
cgttccagtggacattatgcacttgttacacaacaaccacttagaggaaggtccaagcaaggaggacaacgggtaggaga
aatggaggtttgggctctagagggatttggtgttgctcatattttacaagaaatgcttacttataaatctgatcatatta
gagctcgccaagaagtacttgggactacgatcattggaggaacaatacctaaacccgaagatgctccagaatcttttcga
ttgctcgtccgagaattacgatctttggctctggaactgaatcatttccttgtatctgagaagaacttccagattaatag
gaaggaagcttaa
back to top
>NC_018112.1-rpoB.m143213
atgctcggggatgaaaatggggaaatgtctacaatacctgggttgaatcagatacaatttgaaggattttgtgggttcat
ggatcggggcttaacagaagaactttataagtttccaaaaattgaagatacagagcaagaaattgaatttcaattatttg
tggaaacatatcaattggtggaaccgttgataaaagaaagggatgctgtatatgaatcactcacatattcttctgaatta
tatgtatccgcaggattaatttggaaaaccagtaaggatatgcaagaacaaacaatttttattggaaacattcctttaat
gaactccctcggaacttctatagtaaatggaatatacagaattgtgatcaatcaaatattgcaaagccccggtatctatt
atcgatcagaattggatcataacggaatttcggtctatactggtaccataatatcagattggggagggaggttagaatta
gagattgatagaaaagcaaggatatgggctcgtgtaagtaggaaacagaaaatatctattctagttctatcatcagctat
gggttcgaatctaagagaaattctagagaatgtttgctaccctgagattttcttgtctttcctgaccgataaggaaaaaa
aaaaaattgggtcaaaagaaaatgccattttggagttttatcaacaattttcttgtgtaggcggggatccggtattttct
gaatccttgtgtaaggaattacaaaagaaattctttcagcaaagatgtgaattaggaaggattggtcgacgaaatatgaa
ccagagattgaatcttaatatacctcagaacaatacatttttgttaccgcgagatatattggcagctgcggatcgtttga
ttggaatgaaatttggaatgggtacacttgacgatatgaatcatttgaaaaataagcgtattcgttctgtagcggatctc
ttacaagatcaattcggattggctctggttcgtttagaaaatgtagttagaggaactatatgcggagcaattaggcataa
attgataccgactcctcagaatttggtaacttcgactccattaacaaccacttatgaatcctttttcggattacacccat
tgtctcaagttttggatcgaacaaatccattgacacaaatagtgcatgggagaaaattgagttatttgggccccggagga
ttgaccgggcgaactgctaattttcggatacgagatatccatcctagtcactatggacgcatttgcccaattgacacgtc
tgaagggatcaatgttggacttatcggatccttagcaattcatgccaggattggtcattgggggtctctagaaagtccat
tttataaaatctttgagagatcaaaaaaagcacagatgctttatttatccccccgtcgagatgaatattatatggtagcg
gcaggaaattctttggccttgaatcagggtattcaggaagaacaggttgttccggctcgataccgccaagaattcctgac
tattgcatgggaacaagttcatcttcgaagtatttttccttttcaatatttttcgattggagcttccctcattcctttta
tcgagcataatgacgcgaatcgggctttaatgagttctaatatgcaacgccaagcagttccgctttctcgttccgagaag
tgcattgttggaactgggttggaacgccaagtggctctagattcaggagttcccgctatagccgatcacgagggaaagat
catttctaccgatactgacaagattattttatcgagcaatggagatgctctaggcattccattagttatgtatcaacgtt
ccaacaaaaatacttgtatgcatcaaactgcccgggttcggcggggtaaatgcattaaaaaggggcaaattttagcggac
ggtgccgctacggttggtggcgaactcgctttgggcaaaaacgtactagtagcttatatgccatgggaaggttacaattt
tgaggatgcggtactcattagcgagcgtctagtatatgaagatatttatacttcttttcacatacgaaaatatgaaattc
agactcatgtgacaagccaaggtcctgaaagaatcactaacgaaataccgcacctagaagcccatttactccgcaattta
gacaaaaatggaattgtgatgctgggatcttgggtggagacaggcgatattttagtaggtaaattaacgcctcaggtggc
gaaagaatcatcgtatgctccagaagatagattattacgggccatacttgggattcaggtatccacttcaaaggaaactt
gtctaaaattacctataggtgggaggggtcgagtcatcgatgtgagatgggtccagaaaaaagggggttctagttataat
ccggaaacgattcgtgtatatatttcacagaaacgcgaaatcaaagtaggcgataaagtagccggaaggcatggaaataa
agggatcatttcaaaaattttacctagacaggatatgccttatttgcaagacggaagacctgttgatatggtcttcaacc
cattaggagtaccttcacgaatgaatgtaggacagctatttgaatgctcgcttgggttagcagggagtctactagataga
cattatcgaatagcaccatttgatgagagatatgaacaagaggcttcgagaaaactagtgttttccgaattatatcaagc
cagtaagcaaacagcgaatccatgggtatttgaacccgaatatccaggaaaaagcagaatatttgatggaagaacgggag
gcccctttgagcaacctgttataataggaaaaccttatatcttgaaattaattcatcaagttgatgataaaatacatggg
cgttccagtggacattatgcacttgttacacaacaaccacttagaggaaggtccaagcaaggaggacaacgggtaggaga
aatggaggtttgggctctagagggatttggtgttgctcatattttacaagaaatgcttacttataaatctgatcatatta
gagctcgccaagaagtacttgggactacgatcattggaggaacaatacctaaacccgaagatgctccagaatcttttcga
ttgctcgtccgagaattacgatctttggctctggaactgaatcatttccttgtatctgagaagaacttccagattaatag
gaaggaagcttaa
back to top
>JN019795.1-rpoB.m143213
atgctcggggatgaaaatggggaaatgtctacaatacctgggttgaatcagatacaatttgaaggattttgtgggttcat
ggatcggggcttaacagaagaactttataagtttccaaaaattgaagatacagagcaagaaattgaatttcaattatttg
tggaaacatatcaattggtggaaccgttgataaaagaaagggatgctgtatatgaatcactcacatattcttctgaatta
tatgtatccgcaggattaatttggaaaaccagtaaggatatgcaagaacaaacaatttttattggaaacattcctttaat
gaactccctcggaacttctatagtaaatggaatatacagaattgtgatcaatcaaatattgcaaagccccggtatctatt
atcgatcagaattggatcataacggaatttcggtctatactggtaccataatatcagattggggagggaggttagaatta
gagattgatagaaaagcaaggatatgggctcgtgtaagtaggaaacagaaaatatctattctagttctatcatcagctat
gggttcgaatctaagagaaattctagagaatgtttgctaccctgagattttcttgtctttcctgaccgataaggaaaaaa
aaaaaattgggtcaaaagaaaatgccattttggagttttatcaacaattttcttgtgtaggcggggatccggtattttct
gaatccttgtgtaaggaattacaaaagaaattctttcagcaaagatgtgaattaggaaggattggtcgacgaaatatgaa
ccagagattgaatcttaatatacctcagaacaatacatttttgttaccgcgagatatattggcagctgcggatcgtttga
ttggaatgaaatttggaatgggtacacttgacgatatgaatcatttgaaaaataagcgtattcgttctgtagcggatctc
ttacaagatcaattcggattggctctggttcgtttagaaaatgtagttagaggaactatatgcggagcaattaggcataa
attgataccgactcctcagaatttggtaacttcgactccattaacaaccacttatgaatcctttttcggattacacccat
tgtctcaagttttggatcgaacaaatccattgacacaaatagtgcatgggagaaaattgagttatttgggccccggagga
ttgaccgggcgaactgctaattttcggatacgagatatccatcctagtcactatggacgcatttgcccaattgacacgtc
tgaagggatcaatgttggacttatcggatccttagcaattcatgccaggattggtcattgggggtctctagaaagtccat
tttataaaatctttgagagatcaaaaaaagcacagatgctttatttatccccccgtcgagatgaatattatatggtagcg
gcaggaaattctttggccttgaatcagggtattcaggaagaacaggttgttccggctcgataccgccaagaattcctgac
tattgcatgggaacaagttcatcttcgaagtatttttccttttcaatatttttcgattggagcttccctcattcctttta
tcgagcataatgacgcgaatcgggctttaatgagttctaatatgcaacgccaagcagttccgctttctcgttccgagaag
tgcattgttggaactgggttggaacgccaagtggctctagattcaggagttcccgctatagccgatcacgagggaaagat
catttctaccgatactgacaagattattttatcgagcaatggagatgctctaggcattccattagttatgtatcaacgtt
ccaacaaaaatacttgtatgcatcaaactgcccgggttcggcggggtaaatgcattaaaaaggggcaaattttagcggac
ggtgccgctacggttggtggcgaactcgctttgggcaaaaacgtactagtagcttatatgccatgggaaggttacaattt
tgaggatgcggtactcattagcgagcgtctagtatatgaagatatttatacttcttttcacatacgaaaatatgaaattc
agactcatgtgacaagccaaggtcctgaaagaatcactaacgaaataccgcacctagaagcccatttactccgcaattta
gacaaaaatggaattgtgatgctgggatcttgggtggagacaggcgatattttagtaggtaaattaacgcctcaggtggc
gaaagaatcatcgtatgctccagaagatagattattacgggccatacttgggattcaggtatccacttcaaaggaaactt
gtctaaaattacctataggtgggaggggtcgagtcatcgatgtgagatgggtccagaaaaaagggggttctagttataat
ccggaaacgattcgtgtatatatttcacagaaacgcgaaatcaaagtaggcgataaagtagccggaaggcatggaaataa
agggatcatttcaaaaattttacctagacaggatatgccttatttgcaagacggaagacctgttgatatggtcttcaacc
cattaggagtaccttcacgaatgaatgtaggacagctatttgaatgctcgcttgggttagcagggagtctactagataga
cattatcgaatagcaccatttgatgagagatatgaacaagaggcttcgagaaaactagtgttttccgaattatatcaagc
cagtaagcaaacagcgaatccatgggtatttgaacccgaatatccaggaaaaagcagaatatttgatggaagaacgggag
gcccctttgagcaacctgttataataggaaaaccttatatcttgaaattaattcatcaagttgatgataaaatacatggg
cgttccagtggacattatgcacttgttacacaacaaccacttagaggaaggtccaagcaaggaggacaacgggtaggaga
aatggaggtttgggctctagagggatttggtgttgctcatattttacaagaaatgcttacttataaatctgatcatatta
gagctcgccaagaagtacttgggactacgatcattggaggaacaatacctaaacccgaagatgctccagaatcttttcga
ttgctcgtccgagaattacgatctttggctctggaactgaatcatttccttgtatctgagaagaacttccagattaatag
gaaggaagcttaa
back to top
>NC_018112.1-rpoB3213
atgctcggggatgaaaatggggaaatgtctacaatacctgggttgaatcagatacaatttgaaggattttgtgggttcat
ggatcggggcttaacagaagaactttataagtttccaaaaattgaagatacagagcaagaaattgaatttcaattatttg
tggaaacatatcaattggtggaaccgttgataaaagaaagggatgctgtatatgaatcactcacatattcttctgaatta
tatgtatccgcaggattaatttggaaaaccagtaaggatatgcaagaacaaacaatttttattggaaacattcctttaat
gaactccctcggaacttctatagtaaatggaatatacagaattgtgatcaatcaaatattgcaaagccccggtatctatt
atcgatcagaattggatcataacggaatttcggtctatactggtaccataatatcagattggggagggaggttagaatta
gagattgatagaaaagcaaggatatgggctcgtgtaagtaggaaacagaaaatatctattctagttctatcatcagctat
gggttcgaatctaagagaaattctagagaatgtttgctaccctgagattttcttgtctttcctgaccgataaggaaaaaa
aaaaaattgggtcaaaagaaaatgccattttggagttttatcaacaattttcttgtgtaggcggggatccggtattttct
gaatccttgtgtaaggaattacaaaagaaattctttcagcaaagatgtgaattaggaaggattggtcgacgaaatatgaa
ccagagattgaatcttaatatacctcagaacaatacatttttgttaccgcgagatatattggcagctgcggatcgtttga
ttggaatgaaatttggaatgggtacacttgacgatatgaatcatttgaaaaataagcgtattcgttctgtagcggatctc
ttacaagatcaattcggattggctctggttcgtttagaaaatgtagttagaggaactatatgcggagcaattaggcataa
attgataccgactcctcagaatttggtaacttcgactccattaacaaccacttatgaatcctttttcggattacacccat
tgtctcaagttttggatcgaacaaatccattgacacaaatagtgcatgggagaaaattgagttatttgggccccggagga
ttgaccgggcgaactgctaattttcggatacgagatatccatcctagtcactatggacgcatttgcccaattgacacgtc
tgaagggatcaatgttggacttatcggatccttagcaattcatgccaggattggtcattgggggtctctagaaagtccat
tttataaaatctttgagagatcaaaaaaagcacagatgctttatttatccccccgtcgagatgaatattatatggtagcg
gcaggaaattctttggccttgaatcagggtattcaggaagaacaggttgttccggctcgataccgccaagaattcctgac
tattgcatgggaacaagttcatcttcgaagtatttttccttttcaatatttttcgattggagcttccctcattcctttta
tcgagcataatgacgcgaatcgggctttaatgagttctaatatgcaacgccaagcagttccgctttctcgttccgagaag
tgcattgttggaactgggttggaacgccaagtggctctagattcaggagttcccgctatagccgatcacgagggaaagat
catttctaccgatactgacaagattattttatcgagcaatggagatgctctaggcattccattagttatgtatcaacgtt
ccaacaaaaatacttgtatgcatcaaactgcccgggttcggcggggtaaatgcattaaaaaggggcaaattttagcggac
ggtgccgctacggttggtggcgaactcgctttgggcaaaaacgtactagtagcttatatgccatgggaaggttacaattt
tgaggatgcggtactcattagcgagcgtctagtatatgaagatatttatacttcttttcacatacgaaaatatgaaattc
agactcatgtgacaagccaaggtcctgaaagaatcactaacgaaataccgcacctagaagcccatttactccgcaattta
gacaaaaatggaattgtgatgctgggatcttgggtggagacaggcgatattttagtaggtaaattaacgcctcaggtggc
gaaagaatcatcgtatgctccagaagatagattattacgggccatacttgggattcaggtatccacttcaaaggaaactt
gtctaaaattacctataggtgggaggggtcgagtcatcgatgtgagatgggtccagaaaaaagggggttctagttataat
ccggaaacgattcgtgtatatatttcacagaaacgcgaaatcaaagtaggcgataaagtagccggaaggcatggaaataa
agggatcatttcaaaaattttacctagacaggatatgccttatttgcaagacggaagacctgttgatatggtcttcaacc
cattaggagtaccttcacgaatgaatgtaggacagctatttgaatgctcgcttgggttagcagggagtctactagataga
cattatcgaatagcaccatttgatgagagatatgaacaagaggcttcgagaaaactagtgttttccgaattatatcaagc
cagtaagcaaacagcgaatccatgggtatttgaacccgaatatccaggaaaaagcagaatatttgatggaagaacgggag
gcccctttgagcaacctgttataataggaaaaccttatatcttgaaattaattcatcaagttgatgataaaatacatggg
cgttccagtggacattatgcacttgttacacaacaaccacttagaggaaggtccaagcaaggaggacaacgggtaggaga
aatggaggtttgggctctagagggatttggtgttgctcatattttacaagaaatgcttacttataaatctgatcatatta
gagctcgccaagaagtacttgggactacgatcattggaggaacaatacctaaacccgaagatgctccagaatcttttcga
ttgctcgtccgagaattacgatctttggctctggaactgaatcatttccttgtatctgagaagaacttccagattaatag
gaaggaagcttaa
back to top
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
rpoBJN019795.1-rpoBGossypium areysianumgene
rpoBNC_018112.1-rpoBGossypium areysianumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
rpoBNC_018112.1-rpoB.m14Gossypium areysianummRNA
rpoBJN019795.1-rpoB.m14Gossypium areysianummRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
CottonGen Gene Database2017-09-06