rpoC2, rpoC2 (gene) Gossypium areysianum

Gene Overview
Name rpoC2
Gene Symbol rpoC2
Type gene
Organism Gossypium areysianum
Synonym RNA polymerase beta'' subunit
Description NA
Comment RNA polymerase beta'' chain
Evidence for the gene structure imported from NCBI
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Name Genome Location NCBI Accession
JN019795.1-rpoC2 N/A JN019795.1
NC_018112.1-rpoC2.m12 N/A NC_018112.1
JN019795.1-rpoC2.m12 N/A JN019795.1
NC_018112.1-rpoC2 N/A NC_018112.1

Sequence(s):
>JN019795.1-rpoC24182
atggcagaacgggccaatctggtatttcacaataaagtgatagatggaactgccattaaacggcttattagcagattaat
agatcacttcggaatggcatatacatcacacatcctggatcaagtaaaagctctgggtttccagcaagccactgctacat
ccatttcattaggaattgatgatcttttaacgataccttctaagggatggctagtccaagatgctgaacaacaaagtttg
attttggaaaaacaccatcattttgggaatgtacacgcggtagaaaaattacgccaatcaattgagatatggtatgctac
aagtgaatatttgcgacaagaaatgaatcctaattttaggatgactgacccgtttaacccagtccatataatgtcttttt
caggagctagaggaaatgcatctcaagtgcaccaattagtaggtatgagaggattaatgtcggatccccaaggacaaatg
atcgatttacccattcaaagcaatttacgcgaaggactgtctttaacagaatatataatttcttgctacggagcccgaaa
aggggttgtggataccgccgtacgaacatcagatgctggatatcttacgcgcagacttgttgaagtagttcaacacattg
ttgtacgtagaacagattgtggcaccacccgagggatttctgtgagtcctcaaaagaggacgcttccggaaagaattttt
atccaaacattaattggtcgtgtattagcggacgatatatatatgggtccgcggtgcattgccattcgaaatcaagatat
tgggcttgggcttgtcgatcgattcagagcctttcgaacacaaccaatatctattcgaactccctttacttgtaggagta
catcttggatttgtcgattatgttatggtcggagccccactcatggtgacctggttgaattgggagaagctgtaggtatt
attgcggggcaatccattggagaaccgggaacgcaactaacattaagaacttttcataccggcggagtatttacaggggg
tactgcagaacatgtacgagccccttttaatggaaaaatcaaattcaatgaggatttggttcatcctacacgcacacgtc
acgggcatcctgcttttttatgttatctggacttggatgtaattattgagagtgaagatattatacataaggtgactatt
ccaccaaaaagttttcttttagttcaaaacgatcaatatgtagaatcagaacaagtgattgctgagattcgcgcgggaac
atacactttaaatttgaaagagagggttcgaaaacatatttattctgactcagagggggaaatgcactggagtaccgatg
tgtaccattcgcccgaatttacatatagtaatgtccatctcttaccaaaaacaagccatttgtggatattatcagggggt
tcgtacaaattcagtgtagttcctttttcgctccacaaggatcaagatcaaataaacattcattatctttctgccgaacg
aagatatatttctagattctcagtgaataatgatcaagtgagacacaacttatttagttcggatttttcggataaaaaag
aagataggatttacgattattcagaattgaatcgaataataggtactgggcattgtgatttcatatattctgctattctc
cacgagaatgctgatttattggcaaagagacgaagaaatagatttattattccatttcaattgattcaagaccaagagaa
agaactaatgctgcattcccattccggtatctcgatggaaatacccataaatggtattttccgtagaaaaagtattcttg
ctttttttgacgatcctcgatacagaagaaagagttcaggaattactaaatatgggactctaggggcgcattcaatcgtc
aaaagggaggatgtgattgagtatcgaggagtcaaaaaggttaagccaaaataccaaatgaaagtagatcgatttttttt
cattcccgaggaagtgcatattttatccgaatcttcttccataatggtacggaacaatagtatcattggagtagataccc
aaatcactttaaatacaagaagccaagtgggcggattggtccgagtggaaagaaaaaaaaaaaggattgaactgaaaatt
ttttcgggtaatatctattttcccggagaaagagataagatatctcgacacagtggcatcttgataccaccaggaacggg
caaaacaaactctaaggaatcaaaaaaattgaaaaattggatctatgtccaacggatcacacctaccaagaaaaagtatt
ttgttttggttcgacctgtaaccccatatgaaataccggacggtctaaatttagcaacactcttcccccaggatccattt
cgggaaaaagataatatgcaacttcgagctgtcaattatatcctttatggaaatggcaaaccgactcggagaatttctga
cacaagtattcaactagttcggacttgtttagtgttgagttgggaccaagacaacaaaagttctttcgccgaagaggtct
gtgcttcctttgttgaagtaaggacaaatggtctgattcgagatttcctaagaatcgacttagtgaaatctcatattttt
tatatcagaaaaagaaatgatccgtcaggttcagaattgatttctgataatagggcagatcgtaccaataaaaatccgtt
ttattccatttattccaacgcaaggattcaacaatcgtttagccaaaatcacggaactattcatacgctcttgaacagaa
ataaggaatcccaatctttgataattttgtcatcatctaattgttttcgcatgggcccattcaacgatgtaaaatatcac
aatgtgataaaacaatcaattaaaaaagatcctctaattccacttaagaatttattgggtcctttaggaacagcccccaa
aattgcgaatttttattcatcattttaccctttaataactcataatcagacctcggtagcgaaatatttggagcttgaca
atttaaaacaggcttttcaagtacttaactattatttaatagctgaaaatgggagaatttataatttcgatccatgccgt
aacatctttttgaatgcagtcaatttgaattggtattttccccatcatcattatcatcataattattgtgaagaaacgtc
cacaataattagtcttgggcagtttatttgtgaaaatgtatgtatagccaaaagcggaccacgcctaaaatcgggtcaag
tttttattgttcaagctgattctatagtaataagatcggctaagccttatttggcgactccgggagcaactgtccatggg
cattatggagaaatcctttacgaaggagatacgttagtgacatttatatatgaaaaatcgagatctggtgatataacgca
gggtcttccaaaagtggaacaagtgttagaagtgcgttcgattgattcaatatcgatgaacctagaaaagagaattgagg
gttggaacgaatgtataacaagaattcttggaattccttggggattcgtgattggtgctgagctaactatagtgcaaagt
cgtctctctttggttaataagatccaaaaggtttatcgatctcagggggtacagatccataataggcatatagaaattat
tgtacgtcaaataacatcaaaagtattggtttcagaagatggaatgtctaatgtttttttacccggggaacttattggat
tattgcgagcggaacgaacggggcgtgctttagaagaagcgatttgttatcgagccgttttattgggaataacgagagca
tctctgaacactcaaagttttatatctgaagcaagttttcaagaaactgctcgagttttagcaaaagctgctctccgggg
tcgtatcgattggttgaaaggcctgaaagaaaacgttgtgcttgggggtatgatacccgccggtaccggattcaaaggat
tagtgcaccggtcacggcaacataacaacattcttttggaaacaaaaaaaaagaatttcttcgggggagaaatgagagat
attttcttccaccaccgagaattatttgactcttgcatttcaaacaatttacatgatacatcaggccgctcttttatagg
tatagaatttaatgattcttaa
back to top
>NC_018112.1-rpoC2.m124182
atggcagaacgggccaatctggtatttcacaataaagtgatagatggaactgccattaaacggcttattagcagattaat
agatcacttcggaatggcatatacatcacacatcctggatcaagtaaaagctctgggtttccagcaagccactgctacat
ccatttcattaggaattgatgatcttttaacgataccttctaagggatggctagtccaagatgctgaacaacaaagtttg
attttggaaaaacaccatcattttgggaatgtacacgcggtagaaaaattacgccaatcaattgagatatggtatgctac
aagtgaatatttgcgacaagaaatgaatcctaattttaggatgactgacccgtttaacccagtccatataatgtcttttt
caggagctagaggaaatgcatctcaagtgcaccaattagtaggtatgagaggattaatgtcggatccccaaggacaaatg
atcgatttacccattcaaagcaatttacgcgaaggactgtctttaacagaatatataatttcttgctacggagcccgaaa
aggggttgtggataccgccgtacgaacatcagatgctggatatcttacgcgcagacttgttgaagtagttcaacacattg
ttgtacgtagaacagattgtggcaccacccgagggatttctgtgagtcctcaaaagaggacgcttccggaaagaattttt
atccaaacattaattggtcgtgtattagcggacgatatatatatgggtccgcggtgcattgccattcgaaatcaagatat
tgggcttgggcttgtcgatcgattcagagcctttcgaacacaaccaatatctattcgaactccctttacttgtaggagta
catcttggatttgtcgattatgttatggtcggagccccactcatggtgacctggttgaattgggagaagctgtaggtatt
attgcggggcaatccattggagaaccgggaacgcaactaacattaagaacttttcataccggcggagtatttacaggggg
tactgcagaacatgtacgagccccttttaatggaaaaatcaaattcaatgaggatttggttcatcctacacgcacacgtc
acgggcatcctgcttttttatgttatctggacttggatgtaattattgagagtgaagatattatacataaggtgactatt
ccaccaaaaagttttcttttagttcaaaacgatcaatatgtagaatcagaacaagtgattgctgagattcgcgcgggaac
atacactttaaatttgaaagagagggttcgaaaacatatttattctgactcagagggggaaatgcactggagtaccgatg
tgtaccattcgcccgaatttacatatagtaatgtccatctcttaccaaaaacaagccatttgtggatattatcagggggt
tcgtacaaattcagtgtagttcctttttcgctccacaaggatcaagatcaaataaacattcattatctttctgccgaacg
aagatatatttctagattctcagtgaataatgatcaagtgagacacaacttatttagttcggatttttcggataaaaaag
aagataggatttacgattattcagaattgaatcgaataataggtactgggcattgtgatttcatatattctgctattctc
cacgagaatgctgatttattggcaaagagacgaagaaatagatttattattccatttcaattgattcaagaccaagagaa
agaactaatgctgcattcccattccggtatctcgatggaaatacccataaatggtattttccgtagaaaaagtattcttg
ctttttttgacgatcctcgatacagaagaaagagttcaggaattactaaatatgggactctaggggcgcattcaatcgtc
aaaagggaggatgtgattgagtatcgaggagtcaaaaaggttaagccaaaataccaaatgaaagtagatcgatttttttt
cattcccgaggaagtgcatattttatccgaatcttcttccataatggtacggaacaatagtatcattggagtagataccc
aaatcactttaaatacaagaagccaagtgggcggattggtccgagtggaaagaaaaaaaaaaaggattgaactgaaaatt
ttttcgggtaatatctattttcccggagaaagagataagatatctcgacacagtggcatcttgataccaccaggaacggg
caaaacaaactctaaggaatcaaaaaaattgaaaaattggatctatgtccaacggatcacacctaccaagaaaaagtatt
ttgttttggttcgacctgtaaccccatatgaaataccggacggtctaaatttagcaacactcttcccccaggatccattt
cgggaaaaagataatatgcaacttcgagctgtcaattatatcctttatggaaatggcaaaccgactcggagaatttctga
cacaagtattcaactagttcggacttgtttagtgttgagttgggaccaagacaacaaaagttctttcgccgaagaggtct
gtgcttcctttgttgaagtaaggacaaatggtctgattcgagatttcctaagaatcgacttagtgaaatctcatattttt
tatatcagaaaaagaaatgatccgtcaggttcagaattgatttctgataatagggcagatcgtaccaataaaaatccgtt
ttattccatttattccaacgcaaggattcaacaatcgtttagccaaaatcacggaactattcatacgctcttgaacagaa
ataaggaatcccaatctttgataattttgtcatcatctaattgttttcgcatgggcccattcaacgatgtaaaatatcac
aatgtgataaaacaatcaattaaaaaagatcctctaattccacttaagaatttattgggtcctttaggaacagcccccaa
aattgcgaatttttattcatcattttaccctttaataactcataatcagacctcggtagcgaaatatttggagcttgaca
atttaaaacaggcttttcaagtacttaactattatttaatagctgaaaatgggagaatttataatttcgatccatgccgt
aacatctttttgaatgcagtcaatttgaattggtattttccccatcatcattatcatcataattattgtgaagaaacgtc
cacaataattagtcttgggcagtttatttgtgaaaatgtatgtatagccaaaagcggaccacgcctaaaatcgggtcaag
tttttattgttcaagctgattctatagtaataagatcggctaagccttatttggcgactccgggagcaactgtccatggg
cattatggagaaatcctttacgaaggagatacgttagtgacatttatatatgaaaaatcgagatctggtgatataacgca
gggtcttccaaaagtggaacaagtgttagaagtgcgttcgattgattcaatatcgatgaacctagaaaagagaattgagg
gttggaacgaatgtataacaagaattcttggaattccttggggattcgtgattggtgctgagctaactatagtgcaaagt
cgtctctctttggttaataagatccaaaaggtttatcgatctcagggggtacagatccataataggcatatagaaattat
tgtacgtcaaataacatcaaaagtattggtttcagaagatggaatgtctaatgtttttttacccggggaacttattggat
tattgcgagcggaacgaacggggcgtgctttagaagaagcgatttgttatcgagccgttttattgggaataacgagagca
tctctgaacactcaaagttttatatctgaagcaagttttcaagaaactgctcgagttttagcaaaagctgctctccgggg
tcgtatcgattggttgaaaggcctgaaagaaaacgttgtgcttgggggtatgatacccgccggtaccggattcaaaggat
tagtgcaccggtcacggcaacataacaacattcttttggaaacaaaaaaaaagaatttcttcgggggagaaatgagagat
attttcttccaccaccgagaattatttgactcttgcatttcaaacaatttacatgatacatcaggccgctcttttatagg
tatagaatttaatgattcttaa
back to top
>JN019795.1-rpoC2.m124182
atggcagaacgggccaatctggtatttcacaataaagtgatagatggaactgccattaaacggcttattagcagattaat
agatcacttcggaatggcatatacatcacacatcctggatcaagtaaaagctctgggtttccagcaagccactgctacat
ccatttcattaggaattgatgatcttttaacgataccttctaagggatggctagtccaagatgctgaacaacaaagtttg
attttggaaaaacaccatcattttgggaatgtacacgcggtagaaaaattacgccaatcaattgagatatggtatgctac
aagtgaatatttgcgacaagaaatgaatcctaattttaggatgactgacccgtttaacccagtccatataatgtcttttt
caggagctagaggaaatgcatctcaagtgcaccaattagtaggtatgagaggattaatgtcggatccccaaggacaaatg
atcgatttacccattcaaagcaatttacgcgaaggactgtctttaacagaatatataatttcttgctacggagcccgaaa
aggggttgtggataccgccgtacgaacatcagatgctggatatcttacgcgcagacttgttgaagtagttcaacacattg
ttgtacgtagaacagattgtggcaccacccgagggatttctgtgagtcctcaaaagaggacgcttccggaaagaattttt
atccaaacattaattggtcgtgtattagcggacgatatatatatgggtccgcggtgcattgccattcgaaatcaagatat
tgggcttgggcttgtcgatcgattcagagcctttcgaacacaaccaatatctattcgaactccctttacttgtaggagta
catcttggatttgtcgattatgttatggtcggagccccactcatggtgacctggttgaattgggagaagctgtaggtatt
attgcggggcaatccattggagaaccgggaacgcaactaacattaagaacttttcataccggcggagtatttacaggggg
tactgcagaacatgtacgagccccttttaatggaaaaatcaaattcaatgaggatttggttcatcctacacgcacacgtc
acgggcatcctgcttttttatgttatctggacttggatgtaattattgagagtgaagatattatacataaggtgactatt
ccaccaaaaagttttcttttagttcaaaacgatcaatatgtagaatcagaacaagtgattgctgagattcgcgcgggaac
atacactttaaatttgaaagagagggttcgaaaacatatttattctgactcagagggggaaatgcactggagtaccgatg
tgtaccattcgcccgaatttacatatagtaatgtccatctcttaccaaaaacaagccatttgtggatattatcagggggt
tcgtacaaattcagtgtagttcctttttcgctccacaaggatcaagatcaaataaacattcattatctttctgccgaacg
aagatatatttctagattctcagtgaataatgatcaagtgagacacaacttatttagttcggatttttcggataaaaaag
aagataggatttacgattattcagaattgaatcgaataataggtactgggcattgtgatttcatatattctgctattctc
cacgagaatgctgatttattggcaaagagacgaagaaatagatttattattccatttcaattgattcaagaccaagagaa
agaactaatgctgcattcccattccggtatctcgatggaaatacccataaatggtattttccgtagaaaaagtattcttg
ctttttttgacgatcctcgatacagaagaaagagttcaggaattactaaatatgggactctaggggcgcattcaatcgtc
aaaagggaggatgtgattgagtatcgaggagtcaaaaaggttaagccaaaataccaaatgaaagtagatcgatttttttt
cattcccgaggaagtgcatattttatccgaatcttcttccataatggtacggaacaatagtatcattggagtagataccc
aaatcactttaaatacaagaagccaagtgggcggattggtccgagtggaaagaaaaaaaaaaaggattgaactgaaaatt
ttttcgggtaatatctattttcccggagaaagagataagatatctcgacacagtggcatcttgataccaccaggaacggg
caaaacaaactctaaggaatcaaaaaaattgaaaaattggatctatgtccaacggatcacacctaccaagaaaaagtatt
ttgttttggttcgacctgtaaccccatatgaaataccggacggtctaaatttagcaacactcttcccccaggatccattt
cgggaaaaagataatatgcaacttcgagctgtcaattatatcctttatggaaatggcaaaccgactcggagaatttctga
cacaagtattcaactagttcggacttgtttagtgttgagttgggaccaagacaacaaaagttctttcgccgaagaggtct
gtgcttcctttgttgaagtaaggacaaatggtctgattcgagatttcctaagaatcgacttagtgaaatctcatattttt
tatatcagaaaaagaaatgatccgtcaggttcagaattgatttctgataatagggcagatcgtaccaataaaaatccgtt
ttattccatttattccaacgcaaggattcaacaatcgtttagccaaaatcacggaactattcatacgctcttgaacagaa
ataaggaatcccaatctttgataattttgtcatcatctaattgttttcgcatgggcccattcaacgatgtaaaatatcac
aatgtgataaaacaatcaattaaaaaagatcctctaattccacttaagaatttattgggtcctttaggaacagcccccaa
aattgcgaatttttattcatcattttaccctttaataactcataatcagacctcggtagcgaaatatttggagcttgaca
atttaaaacaggcttttcaagtacttaactattatttaatagctgaaaatgggagaatttataatttcgatccatgccgt
aacatctttttgaatgcagtcaatttgaattggtattttccccatcatcattatcatcataattattgtgaagaaacgtc
cacaataattagtcttgggcagtttatttgtgaaaatgtatgtatagccaaaagcggaccacgcctaaaatcgggtcaag
tttttattgttcaagctgattctatagtaataagatcggctaagccttatttggcgactccgggagcaactgtccatggg
cattatggagaaatcctttacgaaggagatacgttagtgacatttatatatgaaaaatcgagatctggtgatataacgca
gggtcttccaaaagtggaacaagtgttagaagtgcgttcgattgattcaatatcgatgaacctagaaaagagaattgagg
gttggaacgaatgtataacaagaattcttggaattccttggggattcgtgattggtgctgagctaactatagtgcaaagt
cgtctctctttggttaataagatccaaaaggtttatcgatctcagggggtacagatccataataggcatatagaaattat
tgtacgtcaaataacatcaaaagtattggtttcagaagatggaatgtctaatgtttttttacccggggaacttattggat
tattgcgagcggaacgaacggggcgtgctttagaagaagcgatttgttatcgagccgttttattgggaataacgagagca
tctctgaacactcaaagttttatatctgaagcaagttttcaagaaactgctcgagttttagcaaaagctgctctccgggg
tcgtatcgattggttgaaaggcctgaaagaaaacgttgtgcttgggggtatgatacccgccggtaccggattcaaaggat
tagtgcaccggtcacggcaacataacaacattcttttggaaacaaaaaaaaagaatttcttcgggggagaaatgagagat
attttcttccaccaccgagaattatttgactcttgcatttcaaacaatttacatgatacatcaggccgctcttttatagg
tatagaatttaatgattcttaa
back to top
>NC_018112.1-rpoC24182
atggcagaacgggccaatctggtatttcacaataaagtgatagatggaactgccattaaacggcttattagcagattaat
agatcacttcggaatggcatatacatcacacatcctggatcaagtaaaagctctgggtttccagcaagccactgctacat
ccatttcattaggaattgatgatcttttaacgataccttctaagggatggctagtccaagatgctgaacaacaaagtttg
attttggaaaaacaccatcattttgggaatgtacacgcggtagaaaaattacgccaatcaattgagatatggtatgctac
aagtgaatatttgcgacaagaaatgaatcctaattttaggatgactgacccgtttaacccagtccatataatgtcttttt
caggagctagaggaaatgcatctcaagtgcaccaattagtaggtatgagaggattaatgtcggatccccaaggacaaatg
atcgatttacccattcaaagcaatttacgcgaaggactgtctttaacagaatatataatttcttgctacggagcccgaaa
aggggttgtggataccgccgtacgaacatcagatgctggatatcttacgcgcagacttgttgaagtagttcaacacattg
ttgtacgtagaacagattgtggcaccacccgagggatttctgtgagtcctcaaaagaggacgcttccggaaagaattttt
atccaaacattaattggtcgtgtattagcggacgatatatatatgggtccgcggtgcattgccattcgaaatcaagatat
tgggcttgggcttgtcgatcgattcagagcctttcgaacacaaccaatatctattcgaactccctttacttgtaggagta
catcttggatttgtcgattatgttatggtcggagccccactcatggtgacctggttgaattgggagaagctgtaggtatt
attgcggggcaatccattggagaaccgggaacgcaactaacattaagaacttttcataccggcggagtatttacaggggg
tactgcagaacatgtacgagccccttttaatggaaaaatcaaattcaatgaggatttggttcatcctacacgcacacgtc
acgggcatcctgcttttttatgttatctggacttggatgtaattattgagagtgaagatattatacataaggtgactatt
ccaccaaaaagttttcttttagttcaaaacgatcaatatgtagaatcagaacaagtgattgctgagattcgcgcgggaac
atacactttaaatttgaaagagagggttcgaaaacatatttattctgactcagagggggaaatgcactggagtaccgatg
tgtaccattcgcccgaatttacatatagtaatgtccatctcttaccaaaaacaagccatttgtggatattatcagggggt
tcgtacaaattcagtgtagttcctttttcgctccacaaggatcaagatcaaataaacattcattatctttctgccgaacg
aagatatatttctagattctcagtgaataatgatcaagtgagacacaacttatttagttcggatttttcggataaaaaag
aagataggatttacgattattcagaattgaatcgaataataggtactgggcattgtgatttcatatattctgctattctc
cacgagaatgctgatttattggcaaagagacgaagaaatagatttattattccatttcaattgattcaagaccaagagaa
agaactaatgctgcattcccattccggtatctcgatggaaatacccataaatggtattttccgtagaaaaagtattcttg
ctttttttgacgatcctcgatacagaagaaagagttcaggaattactaaatatgggactctaggggcgcattcaatcgtc
aaaagggaggatgtgattgagtatcgaggagtcaaaaaggttaagccaaaataccaaatgaaagtagatcgatttttttt
cattcccgaggaagtgcatattttatccgaatcttcttccataatggtacggaacaatagtatcattggagtagataccc
aaatcactttaaatacaagaagccaagtgggcggattggtccgagtggaaagaaaaaaaaaaaggattgaactgaaaatt
ttttcgggtaatatctattttcccggagaaagagataagatatctcgacacagtggcatcttgataccaccaggaacggg
caaaacaaactctaaggaatcaaaaaaattgaaaaattggatctatgtccaacggatcacacctaccaagaaaaagtatt
ttgttttggttcgacctgtaaccccatatgaaataccggacggtctaaatttagcaacactcttcccccaggatccattt
cgggaaaaagataatatgcaacttcgagctgtcaattatatcctttatggaaatggcaaaccgactcggagaatttctga
cacaagtattcaactagttcggacttgtttagtgttgagttgggaccaagacaacaaaagttctttcgccgaagaggtct
gtgcttcctttgttgaagtaaggacaaatggtctgattcgagatttcctaagaatcgacttagtgaaatctcatattttt
tatatcagaaaaagaaatgatccgtcaggttcagaattgatttctgataatagggcagatcgtaccaataaaaatccgtt
ttattccatttattccaacgcaaggattcaacaatcgtttagccaaaatcacggaactattcatacgctcttgaacagaa
ataaggaatcccaatctttgataattttgtcatcatctaattgttttcgcatgggcccattcaacgatgtaaaatatcac
aatgtgataaaacaatcaattaaaaaagatcctctaattccacttaagaatttattgggtcctttaggaacagcccccaa
aattgcgaatttttattcatcattttaccctttaataactcataatcagacctcggtagcgaaatatttggagcttgaca
atttaaaacaggcttttcaagtacttaactattatttaatagctgaaaatgggagaatttataatttcgatccatgccgt
aacatctttttgaatgcagtcaatttgaattggtattttccccatcatcattatcatcataattattgtgaagaaacgtc
cacaataattagtcttgggcagtttatttgtgaaaatgtatgtatagccaaaagcggaccacgcctaaaatcgggtcaag
tttttattgttcaagctgattctatagtaataagatcggctaagccttatttggcgactccgggagcaactgtccatggg
cattatggagaaatcctttacgaaggagatacgttagtgacatttatatatgaaaaatcgagatctggtgatataacgca
gggtcttccaaaagtggaacaagtgttagaagtgcgttcgattgattcaatatcgatgaacctagaaaagagaattgagg
gttggaacgaatgtataacaagaattcttggaattccttggggattcgtgattggtgctgagctaactatagtgcaaagt
cgtctctctttggttaataagatccaaaaggtttatcgatctcagggggtacagatccataataggcatatagaaattat
tgtacgtcaaataacatcaaaagtattggtttcagaagatggaatgtctaatgtttttttacccggggaacttattggat
tattgcgagcggaacgaacggggcgtgctttagaagaagcgatttgttatcgagccgttttattgggaataacgagagca
tctctgaacactcaaagttttatatctgaagcaagttttcaagaaactgctcgagttttagcaaaagctgctctccgggg
tcgtatcgattggttgaaaggcctgaaagaaaacgttgtgcttgggggtatgatacccgccggtaccggattcaaaggat
tagtgcaccggtcacggcaacataacaacattcttttggaaacaaaaaaaaagaatttcttcgggggagaaatgagagat
attttcttccaccaccgagaattatttgactcttgcatttcaaacaatttacatgatacatcaggccgctcttttatagg
tatagaatttaatgattcttaa
back to top
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
rpoC2JN019795.1-rpoC2Gossypium areysianumgene
rpoC2NC_018112.1-rpoC2Gossypium areysianumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
rpoC2NC_018112.1-rpoC2.m12Gossypium areysianummRNA
rpoC2JN019795.1-rpoC2.m12Gossypium areysianummRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
CottonGen Gene Database2017-09-06