rps2, rps2 (gene) Gossypium areysianum

Gene Overview
Name rps2
Gene Symbol rps2
Type gene
Organism Gossypium areysianum
Synonym ribosomal protein S2
Description NA
Comment 30S ribosomal protein S2
Evidence for the gene structure imported from NCBI
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Name Genome Location NCBI Accession
JN019795.1-rps2 N/A JN019795.1
NC_018112.1-rps2.m11 N/A NC_018112.1
JN019795.1-rps2.m11 N/A JN019795.1
NC_018112.1-rps2 N/A NC_018112.1

Sequence(s):
>JN019795.1-rps2711
atggcaagaagatattggaacataaatttggaagagatgttggaagcaggagttcattttggtcatggtactaggaaatg
gaatcctagaatggcgccatatatctctgcaaaacgtaagggtattcatattacaaatctgactagaaccgctcgttttt
tatcagaagcttgtgatttagtttttgatgcagcaagtaagggaaaacaattcttaattgttggtaccaaaaataaagcc
gctgattcggtggcgcgggctgcaataagggctcggtgtcattatgttaataaaaaatggctcggtggtatgttaacaaa
ttggcccactacagaaacgaggcttcataagttcagggacttgagaacagaacaaaagacggggggactcaaccgtcttc
cgaaaagagatgcagctatgttgaagagacaattatctcgcttgcaaacatatctgggcgggattaaatatatgacgaga
ttgcctgatattgtaatcatcgttgatcagcaagaagaatatacggctctgcgagaatgtatcactttgggaattccaac
aatttgtttaatcgatacaaatagcgatcccgatctcgcagatatttcgattccagcaaatgatgacgctatagcttcaa
ttcgattaattcttaacaaattagtagtcgcaatttgtgagggtcgttctagctatatacgaaatccttga
back to top
>NC_018112.1-rps2.m11711
atggcaagaagatattggaacataaatttggaagagatgttggaagcaggagttcattttggtcatggtactaggaaatg
gaatcctagaatggcgccatatatctctgcaaaacgtaagggtattcatattacaaatctgactagaaccgctcgttttt
tatcagaagcttgtgatttagtttttgatgcagcaagtaagggaaaacaattcttaattgttggtaccaaaaataaagcc
gctgattcggtggcgcgggctgcaataagggctcggtgtcattatgttaataaaaaatggctcggtggtatgttaacaaa
ttggcccactacagaaacgaggcttcataagttcagggacttgagaacagaacaaaagacggggggactcaaccgtcttc
cgaaaagagatgcagctatgttgaagagacaattatctcgcttgcaaacatatctgggcgggattaaatatatgacgaga
ttgcctgatattgtaatcatcgttgatcagcaagaagaatatacggctctgcgagaatgtatcactttgggaattccaac
aatttgtttaatcgatacaaatagcgatcccgatctcgcagatatttcgattccagcaaatgatgacgctatagcttcaa
ttcgattaattcttaacaaattagtagtcgcaatttgtgagggtcgttctagctatatacgaaatccttga
back to top
>JN019795.1-rps2.m11711
atggcaagaagatattggaacataaatttggaagagatgttggaagcaggagttcattttggtcatggtactaggaaatg
gaatcctagaatggcgccatatatctctgcaaaacgtaagggtattcatattacaaatctgactagaaccgctcgttttt
tatcagaagcttgtgatttagtttttgatgcagcaagtaagggaaaacaattcttaattgttggtaccaaaaataaagcc
gctgattcggtggcgcgggctgcaataagggctcggtgtcattatgttaataaaaaatggctcggtggtatgttaacaaa
ttggcccactacagaaacgaggcttcataagttcagggacttgagaacagaacaaaagacggggggactcaaccgtcttc
cgaaaagagatgcagctatgttgaagagacaattatctcgcttgcaaacatatctgggcgggattaaatatatgacgaga
ttgcctgatattgtaatcatcgttgatcagcaagaagaatatacggctctgcgagaatgtatcactttgggaattccaac
aatttgtttaatcgatacaaatagcgatcccgatctcgcagatatttcgattccagcaaatgatgacgctatagcttcaa
ttcgattaattcttaacaaattagtagtcgcaatttgtgagggtcgttctagctatatacgaaatccttga
back to top
>NC_018112.1-rps2711
atggcaagaagatattggaacataaatttggaagagatgttggaagcaggagttcattttggtcatggtactaggaaatg
gaatcctagaatggcgccatatatctctgcaaaacgtaagggtattcatattacaaatctgactagaaccgctcgttttt
tatcagaagcttgtgatttagtttttgatgcagcaagtaagggaaaacaattcttaattgttggtaccaaaaataaagcc
gctgattcggtggcgcgggctgcaataagggctcggtgtcattatgttaataaaaaatggctcggtggtatgttaacaaa
ttggcccactacagaaacgaggcttcataagttcagggacttgagaacagaacaaaagacggggggactcaaccgtcttc
cgaaaagagatgcagctatgttgaagagacaattatctcgcttgcaaacatatctgggcgggattaaatatatgacgaga
ttgcctgatattgtaatcatcgttgatcagcaagaagaatatacggctctgcgagaatgtatcactttgggaattccaac
aatttgtttaatcgatacaaatagcgatcccgatctcgcagatatttcgattccagcaaatgatgacgctatagcttcaa
ttcgattaattcttaacaaattagtagtcgcaatttgtgagggtcgttctagctatatacgaaatccttga
back to top
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
rps2JN019795.1-rps2Gossypium areysianumgene
rps2NC_018112.1-rps2Gossypium areysianumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
rps2NC_018112.1-rps2.m11Gossypium areysianummRNA
rps2JN019795.1-rps2.m11Gossypium areysianummRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
CottonGen Gene Database2017-09-06