atpI, atpI (gene) Gossypium areysianum

Gene Overview
Name atpI
Gene Symbol atpI
Type gene
Organism Gossypium areysianum
Synonym ATP synthase CF0 A subunit
Description NA
Comment ATPase IV subunit; ATP synthase CF0 A chain
Evidence for the gene structure imported from NCBI
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Name Genome Location NCBI Accession
JN019795.1-atpI N/A JN019795.1
NC_018112.1-atpI.m10 N/A NC_018112.1
JN019795.1-atpI.m10 N/A JN019795.1
NC_018112.1-atpI N/A NC_018112.1

Sequence(s):
>JN019795.1-atpI735
atgaatggtatatcaaacgcactaaacgggttatacgatatctctggtgtggaagtaggccaacatttctattggcaaat
agcaggtttccaagtccatgcccaagtacttattacttcttgggttgtaattgctatcttattaggttccgccgttatcg
ctgttcggaatccacaaaccattccaaccgccggtcaaaatttcttcgaatatgttcttgaattcattcgagacgtaagc
aaaactcagattggagaagaatatggtccatgggttccctttattggaactatgtttctatttatttttgtttctaactg
gtcgggtgctctgttaccttggaaaatcatacaattacctcatggagagttagccgcacccacgaatgatataaatacta
ctgttgctttagctttactcacgtcagtagcatatttctatgcgggtctttcaaaaaaaggattggggtatttcagtaaa
tacattcaacccactccaattcttttacctattaacattttagaggatttcacaaaacccttatcacttagttttcgact
tttcgggaatatattagctgatgaattagtagttgttgttcttgtttctttagtaccttcagtcgtccctatacctgtca
tgttccttggattatttacaagtgggattcaagctcttatttttgcaactttagctgcggcttatataggcgaatccatg
gagggtcatcattga
back to top
>NC_018112.1-atpI.m10735
atgaatggtatatcaaacgcactaaacgggttatacgatatctctggtgtggaagtaggccaacatttctattggcaaat
agcaggtttccaagtccatgcccaagtacttattacttcttgggttgtaattgctatcttattaggttccgccgttatcg
ctgttcggaatccacaaaccattccaaccgccggtcaaaatttcttcgaatatgttcttgaattcattcgagacgtaagc
aaaactcagattggagaagaatatggtccatgggttccctttattggaactatgtttctatttatttttgtttctaactg
gtcgggtgctctgttaccttggaaaatcatacaattacctcatggagagttagccgcacccacgaatgatataaatacta
ctgttgctttagctttactcacgtcagtagcatatttctatgcgggtctttcaaaaaaaggattggggtatttcagtaaa
tacattcaacccactccaattcttttacctattaacattttagaggatttcacaaaacccttatcacttagttttcgact
tttcgggaatatattagctgatgaattagtagttgttgttcttgtttctttagtaccttcagtcgtccctatacctgtca
tgttccttggattatttacaagtgggattcaagctcttatttttgcaactttagctgcggcttatataggcgaatccatg
gagggtcatcattga
back to top
>JN019795.1-atpI.m10735
atgaatggtatatcaaacgcactaaacgggttatacgatatctctggtgtggaagtaggccaacatttctattggcaaat
agcaggtttccaagtccatgcccaagtacttattacttcttgggttgtaattgctatcttattaggttccgccgttatcg
ctgttcggaatccacaaaccattccaaccgccggtcaaaatttcttcgaatatgttcttgaattcattcgagacgtaagc
aaaactcagattggagaagaatatggtccatgggttccctttattggaactatgtttctatttatttttgtttctaactg
gtcgggtgctctgttaccttggaaaatcatacaattacctcatggagagttagccgcacccacgaatgatataaatacta
ctgttgctttagctttactcacgtcagtagcatatttctatgcgggtctttcaaaaaaaggattggggtatttcagtaaa
tacattcaacccactccaattcttttacctattaacattttagaggatttcacaaaacccttatcacttagttttcgact
tttcgggaatatattagctgatgaattagtagttgttgttcttgtttctttagtaccttcagtcgtccctatacctgtca
tgttccttggattatttacaagtgggattcaagctcttatttttgcaactttagctgcggcttatataggcgaatccatg
gagggtcatcattga
back to top
>NC_018112.1-atpI735
atgaatggtatatcaaacgcactaaacgggttatacgatatctctggtgtggaagtaggccaacatttctattggcaaat
agcaggtttccaagtccatgcccaagtacttattacttcttgggttgtaattgctatcttattaggttccgccgttatcg
ctgttcggaatccacaaaccattccaaccgccggtcaaaatttcttcgaatatgttcttgaattcattcgagacgtaagc
aaaactcagattggagaagaatatggtccatgggttccctttattggaactatgtttctatttatttttgtttctaactg
gtcgggtgctctgttaccttggaaaatcatacaattacctcatggagagttagccgcacccacgaatgatataaatacta
ctgttgctttagctttactcacgtcagtagcatatttctatgcgggtctttcaaaaaaaggattggggtatttcagtaaa
tacattcaacccactccaattcttttacctattaacattttagaggatttcacaaaacccttatcacttagttttcgact
tttcgggaatatattagctgatgaattagtagttgttgttcttgtttctttagtaccttcagtcgtccctatacctgtca
tgttccttggattatttacaagtgggattcaagctcttatttttgcaactttagctgcggcttatataggcgaatccatg
gagggtcatcattga
back to top
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
atpIJN019795.1-atpIGossypium areysianumgene
atpINC_018112.1-atpIGossypium areysianumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
atpINC_018112.1-atpI.m10Gossypium areysianummRNA
atpIJN019795.1-atpI.m10Gossypium areysianummRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
CottonGen Gene Database2017-09-06