atpH, atpH (gene) Gossypium areysianum

Gene Overview
Name atpH
Gene Symbol atpH
Type gene
Organism Gossypium areysianum
Synonym ATP synthase CF0 C subunit
Description NA
Comment ATPase III subunit; ATP synthase CF0 C chain
Evidence for the gene structure imported from NCBI
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Name Genome Location NCBI Accession
JN019795.1-atpH N/A JN019795.1
NC_018112.1-atpH.m9 N/A NC_018112.1
JN019795.1-atpH.m9 N/A JN019795.1
NC_018112.1-atpH N/A NC_018112.1

Sequence(s):
>JN019795.1-atpH246
atgaatccactgatttctgccgcttccgttattgctgctgggttggctgtcgggcttgcttctattggacctggagttgg
tcaaggtactgctgcgggccaagctgtagaaggtatcgcgagacaacccgaggcggagggaaaaatacgaggtactttat
tgcttagtttggcttttatggaagctttaacaatttatgggctggttgtagcattggcactcttatttgcgaatcccttt
gtttaa
back to top
>NC_018112.1-atpH.m9246
atgaatccactgatttctgccgcttccgttattgctgctgggttggctgtcgggcttgcttctattggacctggagttgg
tcaaggtactgctgcgggccaagctgtagaaggtatcgcgagacaacccgaggcggagggaaaaatacgaggtactttat
tgcttagtttggcttttatggaagctttaacaatttatgggctggttgtagcattggcactcttatttgcgaatcccttt
gtttaa
back to top
>JN019795.1-atpH.m9246
atgaatccactgatttctgccgcttccgttattgctgctgggttggctgtcgggcttgcttctattggacctggagttgg
tcaaggtactgctgcgggccaagctgtagaaggtatcgcgagacaacccgaggcggagggaaaaatacgaggtactttat
tgcttagtttggcttttatggaagctttaacaatttatgggctggttgtagcattggcactcttatttgcgaatcccttt
gtttaa
back to top
>NC_018112.1-atpH246
atgaatccactgatttctgccgcttccgttattgctgctgggttggctgtcgggcttgcttctattggacctggagttgg
tcaaggtactgctgcgggccaagctgtagaaggtatcgcgagacaacccgaggcggagggaaaaatacgaggtactttat
tgcttagtttggcttttatggaagctttaacaatttatgggctggttgtagcattggcactcttatttgcgaatcccttt
gtttaa
back to top
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
atpHJN019795.1-atpHGossypium areysianumgene
atpHNC_018112.1-atpHGossypium areysianumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
atpHNC_018112.1-atpH.m9Gossypium areysianummRNA
atpHJN019795.1-atpH.m9Gossypium areysianummRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
CottonGen Gene Database2017-09-06