atpF, atpF (gene) Gossypium areysianum

Gene Overview
Name atpF
Gene Symbol atpF
Type gene
Organism Gossypium areysianum
Synonym ATP synthase CF0 B subunit
Description NA
Comment ATPase subunit I
Evidence for the gene structure imported from NCBI
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Name Genome Location NCBI Accession
JN019795.1-atpF N/A JN019795.1
NC_018112.1-atpF.m8 N/A NC_018112.1
JN019795.1-atpF.m8 N/A JN019795.1
NC_018112.1-atpF N/A NC_018112.1

Sequence(s):
>JN019795.1-atpF1359
atgaaaaatgtaaccgattctttcgtttccttgggtcactggccatccgccgggagtttcggggttaataccgatatttt
agcaacaaatccaataaatctaagtgtagtccttggtgtattgatcttttttggaaagggagtgtgtgcgagttgtttat
ttcaagaataggctggattcacccagttgtactttttttcattataactaggaaagaaaagagtgcatgatcccgcgaat
tacttctgaataaatttttaaaatcatattatagaaccatagcatttcgtgattcattggtacatcgactttgattctct
attaaccaataatctgggaacattaacatggttaaggccaaacccgtttgaagttcagatgcagcagggtactctttcta
ctactatgttactaaatacagaaatattttcaaaacaaaaatgttttttcgatataaaacactcatgtcgataaaacgat
ttgagcccctttttccaatgctgaatcgatgacctatgtataaagggagaagaattctttgaatttgaagaaaaaaagaa
acaactttgctgacaaattacaattatacattatacaattctaagtacaattagaaattccaaattatatgtaaattttt
tatttattatttttttattatactttttagttttttgatatattttctattttggtcagaagaatcctccgaatattctg
gtcttggattagtactcagtttcgatattttggaatatgaatagagacgagagggagagggtaagctcattacattagaa
aaaaaagatattgggaattaattcccaataactaagaaataattgagcgtgagagccaaatgaatcgaaaggttcatgtt
tggttcgggaagggatcatggaatttttgaaataaaaaaaaaatgaatggaaagataatctactttcattaagtgattta
ttagataatcgaaaagagaggatcttgaatactattcgaaattcagaagaactacgcgggggggctattgaacggctgga
aaaggcccgggcccgcttacagaaagtagaaatggaggcggatcagtttcgagtgaatggatattctgagatagaacgag
aaaaattgaatttgattaattcaacttataagattttggaacaattagaaaattacaaaaatgaaaccatttattttgaa
caacaaagagcgattaatcaagtccgacaacgggttttccaacaagctttacaaggagctctaggaactctgaatagttc
tttaaacaacgagttacatttacgcaccattagcgctaatattggcttgtttggggtgatgaaagaaataactgattag
back to top
>NC_018112.1-atpF.m8555
atgaaaaatgtaaccgattctttcgtttccttgggtcactggccatccgccgggagtttcggggttaataccgatatttt
agcaacaaatccaataaatctaagtgtagtccttggtgtattgatcttttttggaaagggagtgttaagtgatttattag
ataatcgaaaagagaggatcttgaatactattcgaaattcagaagaactacgcgggggggctattgaacggctggaaaag
gcccgggcccgcttacagaaagtagaaatggaggcggatcagtttcgagtgaatggatattctgagatagaacgagaaaa
attgaatttgattaattcaacttataagattttggaacaattagaaaattacaaaaatgaaaccatttattttgaacaac
aaagagcgattaatcaagtccgacaacgggttttccaacaagctttacaaggagctctaggaactctgaatagttcttta
aacaacgagttacatttacgcaccattagcgctaatattggcttgtttggggtgatgaaagaaataactgattag
back to top
>JN019795.1-atpF.m8555
atgaaaaatgtaaccgattctttcgtttccttgggtcactggccatccgccgggagtttcggggttaataccgatatttt
agcaacaaatccaataaatctaagtgtagtccttggtgtattgatcttttttggaaagggagtgttaagtgatttattag
ataatcgaaaagagaggatcttgaatactattcgaaattcagaagaactacgcgggggggctattgaacggctggaaaag
gcccgggcccgcttacagaaagtagaaatggaggcggatcagtttcgagtgaatggatattctgagatagaacgagaaaa
attgaatttgattaattcaacttataagattttggaacaattagaaaattacaaaaatgaaaccatttattttgaacaac
aaagagcgattaatcaagtccgacaacgggttttccaacaagctttacaaggagctctaggaactctgaatagttcttta
aacaacgagttacatttacgcaccattagcgctaatattggcttgtttggggtgatgaaagaaataactgattag
back to top
>NC_018112.1-atpF1359
atgaaaaatgtaaccgattctttcgtttccttgggtcactggccatccgccgggagtttcggggttaataccgatatttt
agcaacaaatccaataaatctaagtgtagtccttggtgtattgatcttttttggaaagggagtgtgtgcgagttgtttat
ttcaagaataggctggattcacccagttgtactttttttcattataactaggaaagaaaagagtgcatgatcccgcgaat
tacttctgaataaatttttaaaatcatattatagaaccatagcatttcgtgattcattggtacatcgactttgattctct
attaaccaataatctgggaacattaacatggttaaggccaaacccgtttgaagttcagatgcagcagggtactctttcta
ctactatgttactaaatacagaaatattttcaaaacaaaaatgttttttcgatataaaacactcatgtcgataaaacgat
ttgagcccctttttccaatgctgaatcgatgacctatgtataaagggagaagaattctttgaatttgaagaaaaaaagaa
acaactttgctgacaaattacaattatacattatacaattctaagtacaattagaaattccaaattatatgtaaattttt
tatttattatttttttattatactttttagttttttgatatattttctattttggtcagaagaatcctccgaatattctg
gtcttggattagtactcagtttcgatattttggaatatgaatagagacgagagggagagggtaagctcattacattagaa
aaaaaagatattgggaattaattcccaataactaagaaataattgagcgtgagagccaaatgaatcgaaaggttcatgtt
tggttcgggaagggatcatggaatttttgaaataaaaaaaaaatgaatggaaagataatctactttcattaagtgattta
ttagataatcgaaaagagaggatcttgaatactattcgaaattcagaagaactacgcgggggggctattgaacggctgga
aaaggcccgggcccgcttacagaaagtagaaatggaggcggatcagtttcgagtgaatggatattctgagatagaacgag
aaaaattgaatttgattaattcaacttataagattttggaacaattagaaaattacaaaaatgaaaccatttattttgaa
caacaaagagcgattaatcaagtccgacaacgggttttccaacaagctttacaaggagctctaggaactctgaatagttc
tttaaacaacgagttacatttacgcaccattagcgctaatattggcttgtttggggtgatgaaagaaataactgattag
back to top
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
atpFJN019795.1-atpFGossypium areysianumgene
atpFNC_018112.1-atpFGossypium areysianumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
atpFNC_018112.1-atpF.m8Gossypium areysianummRNA
atpFJN019795.1-atpF.m8Gossypium areysianummRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
CottonGen Gene Database2017-09-06