atpA, atpA (gene) Gossypium areysianum

Gene Overview
Name atpA
Gene Symbol atpA
Type gene
Organism Gossypium areysianum
Synonym ATP synthase CF1 alpha subunit
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Name Genome Location NCBI Accession
JN019795.1-atpA N/A JN019795.1
NC_018112.1-atpA.m7 N/A NC_018112.1
JN019795.1-atpA.m7 N/A JN019795.1
NC_018112.1-atpA N/A NC_018112.1

Sequence(s):
>JN019795.1-atpA1524
atggtaactattagagccgacgaaattagtaatattatccgtgaacgtattgagcaatataatagagaagtaaagattgt
aaatactggtaccgtccttcaagtgggcgacggcattgctcgtattcatggtcttgatgaagtaatggcaggtgaattag
tagaatttgaagagggtactataggcattgccctaaatttggaatcaaataatgttggtgttgtattaatgggtgacggt
ttgatgatacaagagggaagttctgtaaaagcaacaggaaaaattgctcagataccagtgagtgaggcttatttgggtcg
tgttataaatgccctggctaagcctattgacggtcggggtgaaatttcagcttctgaatctcggttaattgaatctcctg
ccccaggtattatttcgagacgttccgtttatgagcctcttcaaacaggacttattgctattgattcgatgatccctata
ggacgtggtcagcgagaattaattattggggatagacagaccggtaaaacagcagtagccacggatacgattctcaatca
gcaagggcaaaatgtaatatgtgtttatgtagctattggtcaaaaagcatcttctgtggctcaggtagtgaccactttcc
aagaaaggggagcgatggagtacaccattgtggtagccgaaacggcggattccccagctacattacaatacctcgctcct
tatacaggagctgctttggctgaatattttatgtatcgtgaacgccacaccgtaatcatttatgatgatctttccaagca
agcacaggcttatcgccaaatgtctcttctattacgaagaccgccgggtcgtgaagcttatccaggagatgttttttatt
tgcattcgcgccttttagaaagagccgctaaatcaagttctcagttaggtgaaggaagtatgactgctttaccaatagtt
gagacccagtcgggagacgtttcggcgtatattcctactaatgtgatttccattacagatggacaaatattcttatccgc
cgatctattcaatgctggaatcagacctgctattaatgtggggatttccgtctccagagtaggatcggcggctcaaatta
aagctatgaaacaagtcgctggtaaatcaaaattggaattggcccaattcgccgaattagaagcctttgcacaatttgct
tctgatctcgataaagctactcagaatcaattggcacgaggtcaacgattacgtgagttgcttaaacaatcccaatcagc
tcctcttacggtggcagaacagataagtactatttataccggaacgaatggttatcttgattcattagaaattggacaag
taaggaaatttctcgttgagttacgtacttacttaaaaacgaataaacctcagttccaagaaatcatatcttctaccaag
acattcactgaggaagcggaaacgcttttgaaagacgctattcaggaccaaatggaacgttttcgacttcaggaacaatt
ataa
back to top
>NC_018112.1-atpA.m71524
atggtaactattagagccgacgaaattagtaatattatccgtgaacgtattgagcaatataatagagaagtaaagattgt
aaatactggtaccgtccttcaagtgggcgacggcattgctcgtattcatggtcttgatgaagtaatggcaggtgaattag
tagaatttgaagagggtactataggcattgccctaaatttggaatcaaataatgttggtgttgtattaatgggtgacggt
ttgatgatacaagagggaagttctgtaaaagcaacaggaaaaattgctcagataccagtgagtgaggcttatttgggtcg
tgttataaatgccctggctaagcctattgacggtcggggtgaaatttcagcttctgaatctcggttaattgaatctcctg
ccccaggtattatttcgagacgttccgtttatgagcctcttcaaacaggacttattgctattgattcgatgatccctata
ggacgtggtcagcgagaattaattattggggatagacagaccggtaaaacagcagtagccacggatacgattctcaatca
gcaagggcaaaatgtaatatgtgtttatgtagctattggtcaaaaagcatcttctgtggctcaggtagtgaccactttcc
aagaaaggggagcgatggagtacaccattgtggtagccgaaacggcggattccccagctacattacaatacctcgctcct
tatacaggagctgctttggctgaatattttatgtatcgtgaacgccacaccgtaatcatttatgatgatctttccaagca
agcacaggcttatcgccaaatgtctcttctattacgaagaccgccgggtcgtgaagcttatccaggagatgttttttatt
tgcattcgcgccttttagaaagagccgctaaatcaagttctcagttaggtgaaggaagtatgactgctttaccaatagtt
gagacccagtcgggagacgtttcggcgtatattcctactaatgtgatttccattacagatggacaaatattcttatccgc
cgatctattcaatgctggaatcagacctgctattaatgtggggatttccgtctccagagtaggatcggcggctcaaatta
aagctatgaaacaagtcgctggtaaatcaaaattggaattggcccaattcgccgaattagaagcctttgcacaatttgct
tctgatctcgataaagctactcagaatcaattggcacgaggtcaacgattacgtgagttgcttaaacaatcccaatcagc
tcctcttacggtggcagaacagataagtactatttataccggaacgaatggttatcttgattcattagaaattggacaag
taaggaaatttctcgttgagttacgtacttacttaaaaacgaataaacctcagttccaagaaatcatatcttctaccaag
acattcactgaggaagcggaaacgcttttgaaagacgctattcaggaccaaatggaacgttttcgacttcaggaacaatt
ataa
back to top
>JN019795.1-atpA.m71524
atggtaactattagagccgacgaaattagtaatattatccgtgaacgtattgagcaatataatagagaagtaaagattgt
aaatactggtaccgtccttcaagtgggcgacggcattgctcgtattcatggtcttgatgaagtaatggcaggtgaattag
tagaatttgaagagggtactataggcattgccctaaatttggaatcaaataatgttggtgttgtattaatgggtgacggt
ttgatgatacaagagggaagttctgtaaaagcaacaggaaaaattgctcagataccagtgagtgaggcttatttgggtcg
tgttataaatgccctggctaagcctattgacggtcggggtgaaatttcagcttctgaatctcggttaattgaatctcctg
ccccaggtattatttcgagacgttccgtttatgagcctcttcaaacaggacttattgctattgattcgatgatccctata
ggacgtggtcagcgagaattaattattggggatagacagaccggtaaaacagcagtagccacggatacgattctcaatca
gcaagggcaaaatgtaatatgtgtttatgtagctattggtcaaaaagcatcttctgtggctcaggtagtgaccactttcc
aagaaaggggagcgatggagtacaccattgtggtagccgaaacggcggattccccagctacattacaatacctcgctcct
tatacaggagctgctttggctgaatattttatgtatcgtgaacgccacaccgtaatcatttatgatgatctttccaagca
agcacaggcttatcgccaaatgtctcttctattacgaagaccgccgggtcgtgaagcttatccaggagatgttttttatt
tgcattcgcgccttttagaaagagccgctaaatcaagttctcagttaggtgaaggaagtatgactgctttaccaatagtt
gagacccagtcgggagacgtttcggcgtatattcctactaatgtgatttccattacagatggacaaatattcttatccgc
cgatctattcaatgctggaatcagacctgctattaatgtggggatttccgtctccagagtaggatcggcggctcaaatta
aagctatgaaacaagtcgctggtaaatcaaaattggaattggcccaattcgccgaattagaagcctttgcacaatttgct
tctgatctcgataaagctactcagaatcaattggcacgaggtcaacgattacgtgagttgcttaaacaatcccaatcagc
tcctcttacggtggcagaacagataagtactatttataccggaacgaatggttatcttgattcattagaaattggacaag
taaggaaatttctcgttgagttacgtacttacttaaaaacgaataaacctcagttccaagaaatcatatcttctaccaag
acattcactgaggaagcggaaacgcttttgaaagacgctattcaggaccaaatggaacgttttcgacttcaggaacaatt
ataa
back to top
>NC_018112.1-atpA1524
atggtaactattagagccgacgaaattagtaatattatccgtgaacgtattgagcaatataatagagaagtaaagattgt
aaatactggtaccgtccttcaagtgggcgacggcattgctcgtattcatggtcttgatgaagtaatggcaggtgaattag
tagaatttgaagagggtactataggcattgccctaaatttggaatcaaataatgttggtgttgtattaatgggtgacggt
ttgatgatacaagagggaagttctgtaaaagcaacaggaaaaattgctcagataccagtgagtgaggcttatttgggtcg
tgttataaatgccctggctaagcctattgacggtcggggtgaaatttcagcttctgaatctcggttaattgaatctcctg
ccccaggtattatttcgagacgttccgtttatgagcctcttcaaacaggacttattgctattgattcgatgatccctata
ggacgtggtcagcgagaattaattattggggatagacagaccggtaaaacagcagtagccacggatacgattctcaatca
gcaagggcaaaatgtaatatgtgtttatgtagctattggtcaaaaagcatcttctgtggctcaggtagtgaccactttcc
aagaaaggggagcgatggagtacaccattgtggtagccgaaacggcggattccccagctacattacaatacctcgctcct
tatacaggagctgctttggctgaatattttatgtatcgtgaacgccacaccgtaatcatttatgatgatctttccaagca
agcacaggcttatcgccaaatgtctcttctattacgaagaccgccgggtcgtgaagcttatccaggagatgttttttatt
tgcattcgcgccttttagaaagagccgctaaatcaagttctcagttaggtgaaggaagtatgactgctttaccaatagtt
gagacccagtcgggagacgtttcggcgtatattcctactaatgtgatttccattacagatggacaaatattcttatccgc
cgatctattcaatgctggaatcagacctgctattaatgtggggatttccgtctccagagtaggatcggcggctcaaatta
aagctatgaaacaagtcgctggtaaatcaaaattggaattggcccaattcgccgaattagaagcctttgcacaatttgct
tctgatctcgataaagctactcagaatcaattggcacgaggtcaacgattacgtgagttgcttaaacaatcccaatcagc
tcctcttacggtggcagaacagataagtactatttataccggaacgaatggttatcttgattcattagaaattggacaag
taaggaaatttctcgttgagttacgtacttacttaaaaacgaataaacctcagttccaagaaatcatatcttctaccaag
acattcactgaggaagcggaaacgcttttgaaagacgctattcaggaccaaatggaacgttttcgacttcaggaacaatt
ataa
back to top
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
atpAJN019795.1-atpAGossypium areysianumgene
atpANC_018112.1-atpAGossypium areysianumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
atpANC_018112.1-atpA.m7Gossypium areysianummRNA
atpAJN019795.1-atpA.m7Gossypium areysianummRNA


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
CottonGen Gene Database2017-09-06