trnS-GCU, trnS-GCU (gene) Gossypium areysianum

Gene Overview
Name trnS-GCU
Gene Symbol trnS-GCU
Type gene
Organism Gossypium areysianum
Synonym NA
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Name Genome Location NCBI Accession
JN019795.1-trnS-GCU N/A JN019795.1
NC_018112.1-trnS-GCU N/A NC_018112.1

Sequence(s):
>JN019795.1-trnS-GCU88
ggagagatggctgagtggactaaagcgtcggattgctaatccgttgtgcgagttattcgtaccgagggttcgaatccctc
tctttccg
back to top
>NC_018112.1-trnS-GCU88
ggagagatggctgagtggactaaagcgtcggattgctaatccgttgtgcgagttattcgtaccgagggttcgaatccctc
tctttccg
back to top
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
trnS-GCUJN019795.1-trnS-GCUGossypium areysianumgene
trnS-GCUNC_018112.1-trnS-GCUGossypium areysianumgene


Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
CottonGen Gene Database2017-09-06